Transcript dna review - NVHSIntroBioPiper1

1. Mr. Jones has extremely long legs and Mrs. Jones is
heterozygous for extremely short legs. If extremely
short legs are dominant over extremely long legs,
what percentage of the offspring will have short
legs?
A. 100% short, 0% long
B. 75% short, 25% long
C. 50% short, 50% long
D. 25% short, 75% long
2. If two parents are homozygous for a genetically
inherited recessive trait, what is the probability that
they will have a child who does not have this trait in
his or her phenotype?
A. 0%
B. 25%
C. 50%
D. 100%
Just draw boxes and answers.







Warm-up
Notes
Practice multiple choice questions
Finish Vocab Matching
Jeopardy
Clean-up
Cool-down

TOMORROW- GENETICS EXAM.

Structure of DNA was discovered in the
1950’s by Watson and Crick in England. They
were able to determine the structure of DNA
as a double helix by stealing a photograph of
work done by Rosalind Franklin.

DNA is made up of subunits called
nucleotides. A nucleotide is made up of three
parts: A sugar, A phosphate and A nitrogen
base. The sugar in DNA is called
deoxyribose.

The four nitrogen bases in DNA are: adenine,
cytosine, guanine and thymine. DNA has
base pairing rules: Adenine always pairs with
Thymine and Guanine always pairs with
Cytosine.



What is the complementary DNA strand?
TACAGTCTAGGCATCCAGCAT
ATGTCAGATCCGTAGGTCGTA

DNA replication is the process by which DNA
makes an exact copy of itself prior to cell
division.


1. DNA double helix unwinds.
2. DNA strand is unzipped between the
nitrogen bases. The point at which it is
unzipping is called the replication fork.



3. DNA Polymerase adds nucleotides to each
side of the original DNA strand.
4. When DNA Polymerase reaches the ends of
the strands, two identical copies of the DNA
have been made.
5. Each new strands winds back up into the
double helix structure.




There are three main differences between
DNA and RNA:
1. RNA has the sugar Ribose / DNA has the
sugar Deoxyribose.
2. RNA is single stranded / DNA is double
stranded.
3. In RNA, adenine pairs with uracil / in DNA,
adenine pairs with thymine.
There are three types of RNA:
1. messenger RNA (mRNA) – carries message
from DNA in the nucleus to the ribosome for
protein synthesis.



2. transfer RNA (tRNA) – brings amino acids
to the ribosome for protein synthesis.
3. ribosomal RNA (rRNA) – makes up the
structure of the ribosome.

Protein synthesis is broken down into two
processes: transcription and translation.


Transcription occurs in the nucleus. It is the
process of making mRNA from DNA.


Transcribe the following DNA segment:
TACAGTCTAGGC ATCC AGCAT
AUGUCAGAUCCGUAGGUCGUA

Translation occurs in the cytoplasm at the
ribosome. It is the process of making a
protein from the mRNA.

The ribosome reads the mRNA 3 nucleotides
at a time (a codon). A tRNA molecule brings
the correct amino acid to the ribosome based
on its anti-codon. The ribosome continues
adding amino acids until it reaches a “stop”
codon. It then releases the protein and
begins again.






Break the mRNA segment from above into
codons:
AUG UCA GAU CCG UAG GUC GUA
What are the correct tRNA anti-codons?
UAC AGU CUA GGC AUC CAG CAU
What is the amino acid sequence for the
protein?
Met Ser Asp Pro Stop Val Val

A mutation is any change in a DNA sequence.
These changes can result in the wrong
sequence of amino acids in a protein – which
will cause the protein to function incorrectly.
1. insertion – an extra nucleotide is added to
the sequence.
2. deletion – a nucleotide is removed from the
sequence.
3. inversion – a sequence of nucleotides is
switched.
4. duplication – a nucleotide or sequence of
nucleotides is repeated.
5. substitution – a nucleotide is replaced with a
different nucleotide.

DNA Fingerprinting – separates DNA into
segments and moves them through a gel to
create a banding pattern. This pattern of
bands is compared to crime scene DNA or
parental DNA to determine guilt or paternity.

Cloning – the process of creating genetically
identical individuals from a parent cell.

Recombinant DNA – A gene is removed from
a human chromosome and inserted into
bacterial DNA. This programs the DNA in the
bacteria to produce the chemicals that the
gene is for (ex. insulin). This creates safer
and more cost effective treatment for many
diseases (ex. diabetes).
◦ Restriction Enzymes – cut DNA sequences
between specific base patterns (ex. GGCC or
TATA).
◦ Transgenic Organism – an organism with
DNA from another species.

Human Genome Project – scientists have
worked to map the location of every gene in
the human genome. They have identified
many genes that can lead to diseases and are
working on potential therapies and cures for
these diseases.



10 minutes- complete them on your own first
10 minutes- discuss with your table partner
and decide on an answer
5 minutes- which ones were hard and why?
Do you have to study for the test?
YES
When is the test?
Thursday!
What can I do to study?
Make flashcards, study with a friend, read the
study guide, memorize the study guide, do
practice problems
1. Two tall pea plants have some offspring that
are tall (T) and some that are short (t). The
genotypes of the parents are probably…
A. TT and TT
B. Tt and Tt
C. TT and tt
D. TT and Tt
2. If all of the sons of a normal male have
hemophilia, a sex-linked disorder, and all of
their daughters are carriers, what must be true
about his wife?
A. Her father was normal B. She is a carrier
C. She has hemophilia
D. Her mother was
normal





Warm-up
Review
Genetics Test
Clean-up
Cool-down