Transcript Slide 1
GENETIC MARKERS IN PLANT BREEDING Use Clonal identity Parental analysis Family structure Population structure Gene flow Phylogeography Hybridisation Phylogeny MARKERS IN BIOLOGY 1. Phenotypic markers = Naked eye markers Flower colors, shape of pods, etc.. P = E+G Karl Von Linne (1707-1778) 2. Genotypic (molecular) markers Readily detectable sequence of protein or DNA whose inheritance can be monitored and associated with the trait inheritance independently from the environment: a) protein polymorphisms b) DNA polymorphisms Molecular markers Sequencing (SNPs) Microsatellites (SSRs) Multi-locus fingerprints AFLP (Amplified Fragment Length Polymorphism) RAPD (random amplified polymorphic DNA) chloroplastDNA PCR-RFLP allozymes (protein-electrophoresis) Proteins Polymorphisms Seed storage proteins Isozymes Isozyme Isozyme Starch gel of the isozyme malate dehydrogenase (MDH). The numbers indicate first the MDH locus, and next the allele present (ie. 3-18 is locus 3 allele 18). Some bands are heterodimers (intralocus or interlocus). DNA structure Chromosome to DNA Stretch of nitrogen fixation gene in soybean 1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggagt 661 ctgaaatcac catctacctt tacttaggtt ctgagtgcca aacccaaggc accaggcatg 721 cgtccttgac tccggagcca tcaggcaggc tttcctcagc cttttgcagc caagtctttt 781 agcctattgg tctgagttca gtgtggcagt tggttaggaa agaaggtggt tcttcgacca 841 ctaacagttt ggatttttta ggatgctagt cctttaaaa ………. molecular marker? 1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggag DNA M1 Gene A M2 MFG Gene B MFG AACCTGAAAAGTTACCCTTTAAAGGCTTAAGGAAAAAGGGTTTAACCAAGGAATTCCATCGGGAATTCCG readily detectable sequence of DNA whose inheritance can be monitored and associated with the trait inheritance Image from UV light table Image from computer screen Co-dominant marker Gel configuration P1 P2 O1 O2 Dominant marker P2 O1 Polymorphism Parent 1 : one band Gel configuration P1 Polymorphism -Parent 1 : one band -Parent 2 : a smaller band -Offspring 1 : heterozygote = both bands -Offspring 2 : homozygote parent 1 O2 -Parent 2 : no band -Offspring 1 : homozygote parent 1 -Offspring 2 : ???? Dominant versus Co-dominant Dominant: No distinction between homo- and heterozygotes possible No allele frequencies available AFLP, RAPD Co-dominant: homozygotes can be distinguished from heterozygotes; allele frequencies can be calculated microsatellites, SNP, RFLPs Desirable properties for a good molecular marker * Polymorphic * Co-dominant inheritance * Occurs throughout the genome * Reproducible * Easy, fast and cheap to detect * Selectivity neutral * High resolution with large number of samples Basis for DNA marker technology •Restriction Endonucleases •Polymerase chain reaction (PCR) •DNA-DNA hybridization •DNA sequencing RFLP based markers *Examine differences in size of specific DNA restriction fragments *Require pure, high molecular weight DNA *Usually performed on total cellular genome Endonucleases and restriction sequences Name of the enzyme Number of cutting sites Taq I MboI Alu I Dde I Rsa I Scrf I Msp I Hae III Ssp I 639 623 341 309 286 239 214 196 137 AG CT C TNAG GT AC CC NGG CC GG GG CC AAT ATT Cutting sites TCGA GATC Note: N represent any base : A, T, C or G AAATCGGGACCTAATGGGCC Ind 1 YFG ATTTAGGGCAATTCCAAGGA Ind 2 RFLP techniques RFLP Polymorphisms interpretation MFG 1 2 3 4 5 6 1 2 3 4 5 6 Advantages and disadvantages of RFLP • Advantages – Reproducible – Co-dominant – Simple • Disadvantages – Time consuming – Expensive – Use of radioactive probes DNA/DNA Hybridization Denaturation Elevated temperature Known DNA sequence Polymerase Chain Reaction •Powerful technique for amplifying DNA • Amplified DNA are then separated by gel electrophoresis PCR based methods 1. Reactions conditions *Target DNA ( or template) *Reaction buffer containing the co-factor MgCl2 *One or more primers *Four nucleotides (dATP, dCTP, dGTP, dTTP) *Thermostable DNA polymerase 2. Use of DNA polymerase = an enzyme that can synthesize DNA at elevated temperature ex : Taq = enzyme purified from hot spring bacterium : Thermus aquaticus 3. Thermal cycle *Denaturing step - one to several min at 94-96 º C *Annealing step - one to several min at 50-65 º C *Elongation step - one to several min at 72 º C 4. Repetition –typically 20 to 50 times average 35 times AFLP Markers Most complex of marker technologies Involves cleavage of DNA with two different enzymes Involves ligation of specific linker pairs to the digested DNA Subsets of the DNA are then amplified by PCR AFLP Markers The PCR products are then separated on acrylamide gel 128 linker combinations are readily available Therefore 128 subsets can be amplified Patented technology AFLP Markers Technically demanding Reliable and stable Moderate cost Need to use different kits adapted to the size of the genome being analyzed. Like RAPD markers need to be converted to quick and easy PCR based marker RAPD Markers There are other problems with RAPD markers associated with reliability Because small changes in any variable can change the result, they are unstable as markers RAPD markers need to be converted to stable PCR markers. How? RAPD Markers The polymorphic RAPD marker band is isolated from the gel It is used a template and re-PCRed The new PCR product is cloned and sequenced Once the sequence is determined, new longer and specific primers can be designed RAPD • Amplifies anonymous stretches of DNA using arbitrary primers • Fast and easy method for detecting polymorphisms • Domimant markers • Reproducibility problems RAPD Polymorphisms among landraces of sorghum Sequences of 10-mer RAPD primers RAPD gel configuration Name Sequence OP OP M OP OP OP 5’ 5’ 5’ 5’ 5’ A08 A15 A 17 A19 D02 –GTGACGTAGG- 3’ –TTCCGAACCC- 3’ –GACCGCTTGT- 3’ –CAAACGTCGG- 3’ –GGACCCAACC- 3’ SSR repeats and primers Repeat GGT(5) Sequence GCGCCGAGTTCTAGGGTTTCGGAATTTGAACCGTC GAGGGCTGATGAGGTGGATA ATTGGGCGTCGGTGAAGAAGTCGCTTCCGTCGTTTGAT TCCGGTCGTCAGAATCAGAATCAGAATCGATATGGTG GCAGTGGTGGTGGTGGTGGTGGTTTTGGTGGTGGTGA ATCTAAGGCGGATGGAGTGGATAATTGGGCGGTTGGT AAGAAACCTCTTCCTGTTAG ATCTTATGGCGGTTCTCGTG ATTCTGGAATGGAACCAGATCGCTGGTCTAGAGGTTCT GCTGTGGAACCA….. SSR polymorphisms P1 AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGG P2 AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCG P1 Gel configuration P2 Linkage groups SSR scoring for F 5:6 pop from the cross Anand x N97-3708-13 M 4. SNPs (Single Nucleotide Polymorphisms) SNPs on a DNA strand Hybridization using fluorescent dy •Any two unrelated individuals differ by one base pair every 1,000 or so, referred to as SNPs. •Many SNPs have no effect on cell function and therefore can be used as molecular markers. DNA sequencing Sequencer Sequencing gel Sequencing graph Types of traits =types of markers Single gene trait: seed shape MFG Multigenic trait; ex: plant growth =Quantitative Trait Loci MFG USES OF MOLECULAR MARKER Measure genetic diversity Mapping Tagging Genetic Diversity Define appropriate geographical scales for monitoring and management (epidemology) Establish gene flow mechanism identify the origin of individual (mutation detection) Monitor the effect of management practices manage small number of individual in ex situ collection Establish of identity in cultivar and clones (fingerprint) paternity analysis and forensic Genetic Diversity Gotcha! fingerprints seeds, plantlets early selection of the good allele Mapping The determination of the position and relative distances of gene on chromosome by means of their linkage Genetic map A linear arrangement of genes or genetic markers obtained based on recombination Physical map A linear order of genes or DNA fragments Physical Mapping It contains ordered overlapping cloned DNA fragment The cloned DNA fragments are usually obtained using restriction enzyme digestion QTL Mapping A set of procedures for detecting genes controlling quantitative traits (QTL) and estimating their genetics effects and location To assist selection Marker Assisted Selection Breeding for specific traits in plants and animals is expensive and time consuming The progeny often need to reach maturity before a determination of the success of the cross can be made The greater the complexity of the trait, the more time and effort needed to achieve a desirable result. MAS The goal to MAS is to reduce the time needed to determine if the progeny have trait The second goal is to reduce costs associated with screening for traits If you can detect the distinguishing trait at the DNA level you can identify positive selection very early. Developing a Marker Best marker is DNA sequence responsible for phenotype i.e. gene If you know the gene responsible and has been isolated, compare sequence of wild-type and mutant DNA Develop specific primers to gene that will distinguish the two forms Developing a Marker If gene is unknown, screen contrasting populations Use populations rather than individuals Need to “blend” genetic differences between individual other than trait of interest Developing Markers Cross individual differing in trait you wish to develop a marker Collect progeny and self or polycross the progeny Collect and select the F2 generation for the trait you are interested in Select 5 - 10 individuals in the F2 showing each trait Developing Markers Extract DNA from selected F2s Pool equal amounts of DNA from each individual into two samples - one for each trait Screen pooled or “bulked” DNA with what method of marker method you wish to use Method is called “Bulked Segregant Analysis” Marker Development Other methods to develop population for markers exist but are more expensive and slower to develop Near Isogenic Lines, Recombinant Inbreeds, Single Seed Decent What is the advantage to markers in breeding? Reducing Costs via MAS Example disease resistance • 10000 plants Greenhouse space or field plots • $5000 - $10000 Time 4 months (salary) • $10 - $15000 • total cost = $15 - $25,000 Reducing Costs via MAS PCR-based testing @ $5 sample $50,000 - costs more? Analysis of trait not easily phenotyped E.g: Cadmium in Durum wheat 10000 plants need to reach maturity Cadmium accumulates in seed Reducing costs via MAS $15 - 25 growing costs + analysis Atomic Absorption @ $15 per sample $150,000 + growing costs PCR analysis still $50000 Savings in time and money increase as more traits are analyzed Many biochemical tests cost >$50 sample Marker Assisted Breeding MAS allows for gene pyramiding incorporation of multiple genes for a trait Prevents development of biological resistance to a gene Reduces space requirements - dispose of unwanted plants and animal early QTL study Trait M. 1 M. 2 M. 3 P.1 P.2 I.1 I.2 I.3 I.4 2.5 8.4 7.1 2.5 4.5 2.3 1 3 3 2 2 1 1 3 1 1 3 1 1 3 1 1 2 3 Statistical programs used in molecular marker studies * SAS * ANOVA * Mapmaker * Cartographer Types of population used for molecular markers studies: F2, RILs, Backcrosses (MILs), DH. QTL Mapping