DNA - University of Dayton

download report

Transcript DNA - University of Dayton

DNA
The Secrets it tells us about
Evolution!
Remember:





Gene –
Chromosome –
1 molecule of DNA = 1 chromosome
What are the building blocks of DNA?
What are the building blocks of protein?
How do genes code for genetic traits?

Answer:
1 gene  code for  one protein!

Examples:



Eye color
Hair color
Normal Blood clotting vs. hemophilia
We know how the code works!

CCCGATATTACGCTTAGGTACCGTC

Every 3 bases code for one amino acid!
(See board)
DNA & Evolution

Chimpanzees and Humans share 98-99%
of their DNA!

CCCGTCAGGCTAATACGAGCGGT
CCCGTCGGGCTAATACGAGCGGT

DNA & Evolution



Who can read the human genetic code?
The genetic code is UNIVERSAL!
Practical Implication:
Genetic engineering:
Bacteria are programmed with HUMAN
insulin gene to produce………….?