Transcript DNA ends!
Gil Ast Dep. of Human Molecular Genetics and Biochemistry th Room 1009, 10 floor 640 6893 :Tel Sylabus The Cell by B. Alberts http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Books Essential Cell Biology by Alberts Genetics Science of genes Molecular Biology Gene expression Embryonic stem cells Day 1 Day 2-3 Day 6-9 Day 14 Day 4 Day 5 Each cell in our body contains the same genetic information (DNA) Gene - encodes for protein nucleus The pathway of gene expression A nucleotide H deoxy The sugar of RNA and DNA RNA DNA The base bind position 1 O The bases single strand DNA ssDNA ssDNA 5’-to-3’ (1 Phosphodiester bond direction )2 5’ end )3 3’end upstream and )4 downstream How to describe DNA GAACCTGAGACCTACTGGTCCG Base-paring dsDNA Base pair = bp Double strand DNA = dsDNA Anti-paralel dsDNA ladder .3 Each basepair is called 1bp .4 Anti-parallel .1 Complementary strand .2 C:G and T:A A = 10-10 Gene – a DNA region that is transcribed to RNA, and the RNA with a biological function Gene 3 Intron – a region in the DNA that is transcribed but removed from the mRNA precursor and is not part of the mature mRNA Exons – part of the mature mRNA Introns are found only in eukaryotes Human genome 2.91 billion base pairs 24,000 protein coding genes (~32,000 non-coding genes) 1.5% exons (127 nucleotides) 24% introns (~3,000 nucleotides) 75% intergenic (no genes) Average size of a gene is 27,894 bases Contains an average of 8.8 exons Titin contains 234 exons. We humans are 99.9% identical at the DNA sequence level • There are still ~3 million nucleotide differences among us called SNPs (60,000 within the exons)---that presumably account for differences in disease susceptibility, drug responses, etc. • Polymorphic variation between and within populations • Implications for concepts of “race,” “individuality” 24,000 Duchenne Muscular Dystrophy MOLECULAR BIOLOGY OF THE DISEASE Duchenne Muscular Dystrophy is one of more than twenty different types of muscular dystrophy. The Duchenne type affects only boys and is known to result from a defect in a single important protein in muscle fibers called Dystrophin. The muscle fiber will break down if the Dystrophin is missing and is unable to function properly. As a result, the reduction in the number of good muscle .fibers and the whole muscle becomes weak Summary • • • • • • DNA, Chromosome Centromere, telomere, replication origin Nucleosome, Chromatin, Histone: H1, H2A, H2B, H3, H4 Histone octamer, DNA packaging DNA binding proteins, Histone modifications Histone proteins HDAC HDAC activity HAT מבנה הנוקלאוזום סיכת ביטחון H2A H2B H3 H4 Covalent Modification of core histone tails Acetylation of lysines (K) Mythylation of lysines Phosphorylation of serines (S) Histone acetyl transferase (HAT) Histone deacetylase (HDAC) epigenetics Acetylation Mythylation Total number of chromosomes/somatic (body) cell There is no connection between the number of chromosomes and the genome size, gene content, or any other feature of genomes. It is and essentially independent characteristic. Species Fruit fly Planaria Frog Cat Mouse Macaque Human Dog 8 16 26 38 40 42 46 78 Species Corn Algae Potato Yeast Penicillin mold 20 20 48 32 4 Cockayne syndrome group B (CSB) cells that fail to express CSB protein which causes profound neurological and developmental defects Blue – DNA White - gene Chromosomal fragile sites are loci that are especially prone to forming gaps or breaks on metaphase chromosomes when cells are cultured under conditions that inhibit DNA replication or repair. The relationship of "rare" folate sensitive fragile sites with (CCG)n expansion and, in some cases, genetic disease is well established. Fragile X syndrome What is Fragile X syndrome? Fragile X syndrome is the most common inherited cause of mental impairment, affecting approximately 1 in 2,000 males and 1 in 4,000 females worldwide. Cytogenetic analysis of metaphase spreads demonstrates the presence of the fragile .)site in less than 60% of cells in most affected individuals. In 1991, the fragile X gene (FMR1) was characterized and found to contain a tandem repeated trinucleotide sequence (CGG) near its 5' end. The mutation responsible for fragile X syndrome involves expansion of this repeat segment. The number of CGG repeats in the FMR1 genes of the normal population varies from six to approximately 50. There are two main categories of mutation, premutations of approximately 50 to 200 repeats and full mutations of more than approximately 200 repeats. There is no clear In man 104 to 105 sites a replication rate of 2 kb/minute Origins of replication • In E. coli only one site OriC • In man 104 to 105 sites • The direction of replication is bi-directional OriC OriC OriC The problem – DNA ends! If this shoelace were a chromosome, then these two protective tips would be its The solution: adding repetitive sequences to the ends CHROMOSOME TELOMERE TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG AATCCCAATCCC 5’ 3’ TnAmGo type of minisatellite repeat TTAGGG – human TTTAGGG – Arabidopsis TTGGGG - Tetrahymena TTAGG – Bombyx TTTTAGGG – Chlamydomonas TTTTGGGG – Oxytricha TTAGGC - Ascaris (TG)1-3 - Saccharomyces cereviceae Telomere • • • • senescent cells have shorter telomeres length differs between species in humans 8-14kb long telomere replication occurs late in the cell cycle • Telomeres are shortened by 40-to-200 bases between one cell division to the other. Functions • Provide protection from enzymatic degradation and maintain chromosome stability • Organization of the cellular nucleus by serving as attaching points to the nuclear matrix • Allows end of linear DNA to be replicated completely End-to-end fusion Telomerase 1. Telomerase binds to the telomer and the internal RNA component aligns with the existing telomer repeats. 2. Telomerase synthesizes new repeats using its own RNA component as a template 3. Telomerase repositions itself on the chromosome and the RNA template hybridizes with the DNA once more. Telomerase is not active in most somatic cells Cancer cells have telomerase Dolly is aging too rapidly?….or was born 6 years old (telomers were 80% of normal sheep) Dolly has developed pre-mature arthritis Werner Patient Teenager Age 48 A Japanese-American Werner patient as a teenager (left), and at age 48 (Case #1 Epstein et al, 1966, Medicine 45:177). She had eight children, two of whom were also affected. At 48, she had hair loss and greying, thin extremities, chronic ulcerations of the ankles, atrophy of the skin and her the right eye had been enucleated several years earlier due to acute glaucoma resulting from bilateral cateract extraction at the age of 27. She lived longer than many Werner patients, dying at 57.