Genetic Code exercise

download report

Transcript Genetic Code exercise

Using the Genetic Code
Objective: Translate DNA codes to amino acid sequences of proteins.
Reminder: * When transcribing the code into RNA, A in DNA goes with U in RNA, and
T in DNA goes with A in RNA * The amino acids in the genetic code match the mRNA
codons (not the anti-codons!). * The message is between the Start and Stop codons
only!
Part I: Going Step by Step
Template
Non-Template
AACTACTTACC T TATACGATCTTTA
TTGATGAATGGAATATGCTAGAAAT
1. Write the template DNA strand:
_____________________________________________________
2. Transcribe to mRNA: _________________________________________________
3. Divide into codons: _____ _____ _____ _____ _____ _____ _____ _____ _____
4. List the tRNA anticodons:
(Not to be used in step 5!)_____ _____ _____ _____ _____ _____ _____ _____ _____
5. Write the amino acid sequence of the protein, using the genetic code, and the
CODONS of the mRNA: _______________________________________________
Notes: * Start = AUG. * Amino-acids: Use the first 3 letters. (Methionine = Met)
6. Check yourself: The first letters of the amino acids you put together make up a
word. The word is: _______________________
Part II: Practice
Skipping steps 1 and 4, repeat the process with the following DNA
template strands:
1. AATCTACAGACGCGACTAGCAACGGATTCCC
2. TTCTACCGCTACTAGACATAATCAGGGTAGAGACTAACT
3. CGGTTACTCATACCTAAATTTTATTCCGTGCC
Written by: Michal Danin-Kreiselman, Ph.D.