Transcript Poster - Department of Entomology

ATCCCGCTTTGATATCCGGCTTGAGTCGGTGTGTGCCAACGCGATATGACGGACGTGTGTGCGAGGGTCTCAACTACAGGGATTAGATAGATGATATT
TTAGATATTAGAGGAAAAGAGAGGGGAGCGACGAGGCGAGGGCGAGCTGTAGCTACGGGATCATGCATGCGAAGGGATCGAGCTGACCCACACAC
mtDNA Barcoding for Taxonomic Identification within the Genus Agrilus
CCGCGGCGCGGCATATGCATCTCTCTCAGCGAGAGACATATATATACGATTTTTTATGAGAGTAGCAGGAGGCGAGGCCCCGAGCGCGAGATATATAA
John
T.
Shukle
and
Jeffrey
D.
Holland
AATATAGAGAATAGTATTTTTTAGATATACGCCGCGAGCGCGCGGCGCGCTATATATATATTCTCGCTACGATGTAGCATCGATGCAGATGCGATTATATAT
Department of Entomology, College of Agriculture, Purdue University, 901 West State Street, West Lafayette, IN 47907, USA (4/04/07)
ATGATTATTGGCTAGCTATGCGCGGCGATGGAGACATATATATACGATTTTTTATGAGAGTAGCAGGAGGCGAGGCCCCGAGCGCGAG
Introduction
Taxonomic Relationships
Sequence Variation
0.01
H. memnonius
H_memnonius
fuscipennis
% Occurrence
A. fuscipennis
Between Species
Within Species
60
A. cephalicus
cephalicus1
A. cyanescens
Concepts of Barcoding
% Occurrence
Ecological studies are constantly refining our image of what an ecosystem is and how it
works; however, these studies are often complicated and time consuming due to several
limiting factors, one of which is the need for species level identifications. Studies involving
insects especially rely on fast and accurate identification. Unfortunately, many groups of
insects require a high level of expertise to identify to the species level. Insects have a
major effect on natural ecosystems, either by driving ecosystem services or as disruptive
invasive species. There is a clear need for a faster method of species identification within
these important groups of organisms. The main objectives of my research are: 1. Test the
hypothesis that a standard DNA sequence can differentiate species within the genus
Agrilus, and 2. Develop a searchable DNA barcode database for the genus in the Midwest.
% Sequence Variation
cyanescens
% Sequence Variation
61
DNA barcoding uses sequences of DNA to identify species based on base pair
comparisons. While the concepts behind DNA barcoding should work for most rapidly
evolving genes, mitochondrial genes have become the preferred choice because of their
maternal inheritance, low recombination potential, and
Mitochondrial
lack of insertions and deletions. Within the
DNA strands
mitochondrial genome the cytochrome c oxidase I (COI)
gene was chosen as a standard for DNA barcoding
because of the presence of robust primer locations.
One of the main advantages of DNA barcoding is the
ability to identify an individual to species using very
small amounts of tissue, for example, a single insect leg
or the base of a bird’s feather. While initial studies
have proven the effectiveness of barcoding as a tool for Fig. 1. Mitochondria contain large numbers
species identification, the validity of the technique still of replicates of their circular genomes.
This provides an excellent amount of
needs to be tested at finer resolutions. I chose to test
starting template for PCR reactions.
this technique within the genus Agrilus.
100
A. lacustris
A. celti
60
A. planipennis
DNA was extracted from three legs of specimens collected on purple sticky traps or from
museum specimens, using either a Qiagen DNeasy kit or a modified version of the method
of Lis et al. (1983). Some museum specimens were more than forty years old. PCR
reactions followed the protocol described by Hebert et al. (2002). Forward and reverse
primers from Hebert et al. (2002) were used to
amplify the full 708 bp barcoding region. For
amplification from degraded DNA, degenerate
1 Fresh
2 Dried
versions of primers from Simon et al. (1994)
were used to recover 369 bp and 480 bp
1 Kb
1 Kb
A
A
overlapping fragments internal to the barcoding
B
B
C
C
region (Fig. 3). DNA was direct sequenced bidirectionally through either MWG Biotech or the
low throughput genomics facility at Purdue.
Fig. 3. The success of PCR amplification depended
Pairwise sequence comparisons were done in
on the quality of the template DNA: 1. Fresh
PAUP. The program Clustal X was used for
collected A. planipennis; 2. Dried specimen of A.
multiple sequence alignments and to generate a bilineatus. Three sets of primers were used to
neighbor-joined tree. Overlapping fragments
amplify either (A) the whole 708 bp barcoding
were merged using the Merger tool in EMBOSS. region, or two overlapping internal fragments of (B)
480 bp and (C) 369 bp respectively.
A. bilineatus
cladrastis1
planipennis
A. ferrisi
41
DNA barcoding using the cytochrome c oxidase I (COI) gene will allow species
identification within the genus Agrilus. This will allow the positive identification of
not only Agrilus males but females, larvae, and eggs.
celti
A. cladrastis
Biology of the Agrilus
Methods
Conclusions
58
60
The genus Agrilus is the largest genus within the family Buprestidae, order Coleoptera,
and contains nearly 3,000 described species. Agrilus larvae are borers that feed on the
living tissue of their host. Most species attack the cambial tissue
of woody trees or shrubs, although a few species do feed on
herbaceous plants, generally attacking root or stem tissue. In
native habitats Agrilus target stressed or dying host plants,
providing an ecosystem service by eliminating diseased
individuals of a population. However, when introduced into
ecosystems where host plants lack co-evolutionary resistance, or
where natural predators and parasites are absent, they can
Fig. 2. Galleries in oak caused
become severe pests. The recent infestation of Emerald Ash
by A. bilineatus. High levels of
infestation girdle the host tree. Borer, Agrilus planipennis, is an excellent example of this.
lacustris1
ferrisi
A. ruficollis
Future research will involve expanding the number of species within the database.
Currently I have sequence data for 31 of the approximately 70 species of Agrilus
native to Indiana and the surrounding Midwest. Once complete, a DNA barcode
database of native Agrilus species could be used to identify unknown samples or
facilitate ecological studies.
ruficollis
67
SCALE
1.0%
A. vittaticollis
Divergence
vittaticollis
B
A
Fig. 4. Phylogram showing the taxonomic relationships of 11 species of Agrilus based on full (708 bp) and micro
(369 bp) mtDNA barcodes. For distance/neighbor-joining analysis 1000 bootstrap replicates were performed. The
values at nodes refer to the percentage of replications supporting each node. The click beetle H. memnonius was
used as an outgroup.
LCOF 1490*
5`
1401
Ag1718F°
COI
708 bp
Barcoding Region
Ag1859R°
Fig. 6. Larva of A. bilineatus showing the
characteristic morphology for the genus
Availability of good quality specimens for initial DNA extraction seems to be a
major limiting factor in studies of this kind. The ability to amplify DNA from archived
specimens provides a large sample size to begin barcoding, along with
demonstrating the value of collections.
bilineatus
37
While DNA barcoding is primarily a tool for species
identification, barcode-based trees can provide a
preliminary phylogenetic placement for species.
The number of taxa (species) supported by a tree
based on barcode sequence data is related to the
number of determining characters within the
sequence. Therefore, the longer the sequence the
more taxa can be successfully placed.
3`
2942
Summary
Recent studies have shown the efficacy of mtDNA barcoding to differentiate
morphologically similar species. I used a 708 bp fragment internal in the cytochrome
c oxidase I (COI) gene to evaluate the effectiveness of this technique within the genus
Agrilus. Results indicate that mtDNA barcoding using the COI gene will provide a
viable method to distinguish between species in the genus.
Acknowledgements
HCOR 2198*
Barcoding Region
This work was supported through undergraduate research scholarships from the Purdue
College of Agriculture. Additional financial support came from the Department of Entomology.
Specimens and identification material were generously provided by Arwin Provonsha.
Gene Coding Regions
Forward Primer
Reverse Primer
tRNA Coding Regions
Control Region
Fig. 5. The order of genes on the mitochondrial genome of
Tribolium. The enlarged region shows the position of the
barcoding region within the COI gene and positions of
forward and reverse primers. * Indicates primers from
Hebert et al. (2002). ° Indicates degenerate versions of
primers from Simon et al. (1994).
mtDNA Genome
References
Hebert, Paul D. N, et al. 2002. “Biological identifications through DNA barcodes.” Proc. R. Soc. Lond. Online.
Lis, J. T., et al. 1983. “New heat shock puffs and β-galactosidase activity from transformation of Drosophila with an hsp70lacZ hybrid gene.” Cell 35:403-410.
Simon, N., et al. 1994. “Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of
conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87:651-70.