Transcript Volcanic glass and pyrite

Redox controlled biogeochemical processes affecting
arsenic solubility down a sediment profile
Xianyu Meng* and Joan E. McLean
Abstract
Introduction
The As concentration in 22 of 172 groundwater samples
collected throughout Cache County exceeded the EPA’s
regulation for As in drinking water, 10 µg/L.
Most research efforts have dealt with deep subsurface material
in humid regions of the world. In many of these locations, the
source of As was attributed to the dissolution of As-bearing Fe
oxides. In arid and semi-arid regions, however, the source of As
and the dominant mechanisms of As release to groundwater
may differ from humid environments.
Objectives
 Determine the As mineralogy down a profile from the soil
surface to depth of groundwater in the aquifer solids collected
from an area with elevated As in groundwater;
 Determine if the DARB and As oxidizing bacteria are
present in the solids;
 Determine if pyrite and volcanic glass are present in the
surficial materials and aquifer solids.
Methods
Sampling
Cores were collected at NP1, NP9, and NP13 which is near the
Logan Landfill (Fig.1):
 Surficial cores: from the ground surface to about 1.7 m;
 Aquifer cores: ranged from 1.9-4.9 m below ground surface.
Discussions: Conceptual model
Arsenic profile
 Zone I: Primary and secondary As minerals are continuously deposited
via the weathering of the Salt Lake Formation. The oxidative dissolution
leads to leaching of As(V) from the surface layers;
Total As content ranged from 2,000 µg/kg to 18,000 µg/kg. Although there
were differences among cores, a similar trend, as illustrated for NP9 (Fig. 2),
was observed:
200 N
1400 W
Arsenic concentration in groundwater throughout Cache County,
Utah, exceeds the drinking water limit. Previous studies of
aquifer solids collected from an area near the Logan landfill
revealed that the As in the groundwater is from geologic sources.
In order to determine the geologic sources of As and to explore
the driving force(s) for As release/retention that controls the
spatial variability in As levels in the groundwater, core samples,
consisting of vadose zone, redox transition zone and saturated
zone solids, from the soil surface to the depth of groundwater,
were collected from the same area. Geologic As was not
confined to the deep aquifer solids but was also in the surficial
materials. Primary As minerals may be continuously deposited
potentially via weathering of volcanic rock from the Salt Lake
Formation located along the base of the Wellsville Mountains or
leaching of As-containing minerals from the Bear River Range. In
the redox transition zone, arsenic was sorbed or co-precipitated
with Fe oxides and carbonate minerals. DNA extraction and
analyses indicated that dissimilatory As reducing bacteria (DARB)
and As oxidizing bacteria were present. Reductive dissolution of
Fe oxides works in conjunction with direct microbial As reduction
thereby causing solubilization of As. Arsenic content reached its
maximal value in the saturation zone. The accumulation in this
zone may be due to the retention of As by reformed Fe-sulfides
under sulfate-reducing conditions. Understanding the behavior
of geologic As in this location is important because these
processes may also affect other regions in northern Utah due to
similarity in the geology.
N
Results
Logan Landfill
 Zone I: More than 65% of the total As, mostly as As(V), was extractable
with HCl (dissolution of carbonate and some oxides);
 Zone II: 90% of the As was associated with carbonate and oxide minerals
extractable with HCl;
 Zone III: A decrease in the proportion of HCl extractable As was
accompanied by an increase in As(III) and an accumulation of total As;
 Zone IV: Not sampled;
Figure 1. Locations of the sampling sites (yellow pinhead indicate monitoring
well; red circle indicate the location where the core was collected).
Sample handling
 Zone V: Total As fluctuated, but the HCl extractable As was always less
than 40%.
Cores were sectioned into vadose zone, redox transition zone,
and saturated zone based on redoximorphic features;
Vadose zone solids were air-dried, while all other core
materials were stored under anaerobic conditions.
 Zone IV: Not sampled;
 Zone V: Arsenic in this zone is either incorporated in sulfides or
associated with Fe minerals. Two processes may control As solubilization
in this zone: 1. microbial reductive dissolution of Fe oxides causes As
release; 2. precipitate of acid insoluble As minerals (Meng et al, 2010).
Zone I
Zone I
Arsenic characterization
Secondary As minerals
Fe oxides/
Carbonate minerals
Zone II
Nitric acid digestion was used to determine total As in the
solid phase (USEPA 3050 Method);
Weathering effect/
Microbial activity
Zone III
Zone II
An 0.5 M HCl extraction was used to determine the oxidation
state of acid soluble Fe and As minerals.
Core materials collected at NP9 were sieved for very fine sand
(VFS) and fine sand (FS) fractions then examined for volcanic glass
and pyrite using an Olympus BH-2 petrographic microscope
(Olympus Optical Co., Ltd.).
 Zone III: Sulfide precipitates with Fe to form sulfide minerals that
sequester As;
Primary As minerals
Secondary As minerals
Cores were further sectioned into layers based on solids
characteristics (color, texture, etc.);
Identification of volcanic glass and pyrite
 Zone II: The released As from Zone I is adsorbed to Fe oxides and
carbonate minerals. As the groundwater fluctuates, arsenic is released
through microbial reductive dissolution of Fe oxides (Meng et al, 2010);
Sulfides
Zone IV
Zone III
Zone IV
Identification of DARB and As oxidizing bacteria
1
Sulfide
DNA extraction and PCR amplification were performed on the
surficial materials collected at NP9 to detect:
Sulfide
 DARB: indicated by arrA genes;
Zone V
Zone V
2
Arsenic oxidizing bacteria: indicated by aoxA genes.
Figure 3. Conceptual model of arsenic solubilization controlled by biogeochemical processes.
Table 1. The primers used to amplify the arrA genes and aoxA genes
Gene Primer ID Target sequence (5’-3’)
Reference
AS1F
CGAAGTTCGTCCCGATHACNTGG
Song et al.,
2009
AS1R
GGGGTGCGGTCYTTNARYTC
arrA
AS2F
GTCCCNATBASNTGGGANRARGCNMT
AS2R
ATANGCCCARTGNCCYTGNG
aoxAF
TCCGTTGAGCTATTCGGCGGA
Morais et
al., 2009
aoxBR1
AGCTTGTCGGCTGCATCTGGCC
aoxA
aoxBF
ATCGTTTGGCAATCTGCCTTTC
aoxBR2
TCCGTATAGAGACGCTGGGTG
*Contact information: [email protected] (435)797-3197
Figure 2. Arsenic profile at NP9.
Volcanic glass and pyrite
 The occurrence of volcanic glass in the surficial materials was
negligable, whereas volcanic glass accounted for approximately 25%
of the total VFS and FS in the aquifer solids;
 Pyrite-like minerals, up to 10% of the total, was found in the
surficial materials, while in the aquifer solids the amount of pyrite-like
minerals decreased to 1~2%.
DARB and As oxidizing bacteria in surficial materials
 ArrA genes were identified in Zone I, Zone II, and Zone III;
 AoxA genes were identified in Zone I and Zone II.
Acknowledgements
Utah Water Research Laboratory, Utah State University
Department of Plant, Soil and Climate for sample collection
References
Meng, X., Muruganandam, S., McLean, J.E., 2010. Mobilization of geologic arsenic
in the aquifers of Cache Valley, Northern Utah. Annual meetings of the Soil Soc. Am.
Long Beach, CA, November.
Song, B., Chyun, E., Jaffe, P.R., Ward, B.B., 2009. Molecular methods to detect and
monitor dissimilatory arsenate-respiring bacteria (DARB) in sediments. Fems
Microbiology Ecology 68, 108-117.
Morais, P.V., Branco, R., Francisco, R., Chung, A.P., 2009. Identification of an aox
System That Requires Cytochrome c in the Highly Arsenic-Resistant Bacterium
Ochrobactrum tritici SCII24. Applied and Environmental Microbiology 75, 51415147.