Transcript E.coli
Project in bioinformatics
Conservation of antisense RNA and their
target genes in Bacteria
Pninit Shaked-Mishan
Tal Kaminer
Antisense RNA in bacteria
Antisense RNA are small diffusible trascripts
that pair to target RNAs to control their
biological functions.
Definition of the problem:
E.coli has small RNA molecules that regulate
gene expression.
We want to find out whether those molecules
are conserved in other bacteria.
MicF RNA and his target gene OmpF:
OmpF is a major E.coli outer membrane porin. MicF RNA inhibits
OmpF expression in response to the environment. Unlike most other
cases MicF and OmpF are partially complementary. The mechanism
of inhibition is not completely clear.
DicF and his target gene FtsZ:
The FtsZ gene, which may be involved in initiation of division, is the
target of several inhibitors including DicF RNA. Like the MicF case,
DicF is only partially complementary to its target, the FtsZ mRNA
and the DicF and FtsZ genes are unlinked.
Our tools:
1. NCBI and PubMed For sequence search.
2. Blast and Pairwise blast for sequence alignment
and homology.
3. RNA fold for structure prediction.
MicF RNA :
Actagaataactcccgctatcatcattaactttatttattaccgtcattcatttctgaat E.coli
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Actagaataactcccgctatcatcattaactttatttattaccgtcattcagttctgaat K.pneum
Gtctgtttacccctatttcaaccggatgcctcgcat E.coli
||||||||||||||||||| ||||||||| ||||||
Gtctgtttacccctatttcgaccggatgcttcgcat K.pneum
Score = 167 bits (84), Expect = 2e-40 Identities = 93/96 (96%)
Aaaacaaaaccttcactcgcaactagaataactcccgctatcatcattaactttatttat E.coli
|||||| || ||||| ||||||||| |||| |||||||||||||||||||||||||||||
aaaacagaatcttcattcgcaactaaaatagtgaccgctatcatcattaactttatttat salmonella
Taccgtcattcatttctgaatgtctgtttacccctatttcaaccggatgcctcgcattcg E.coli
|||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||
taccgtcattcacttctgaatgtctgtttacccctatttcaaccggatgcttcgcattcg salmonella
Score = 161 bits (81), Expect = 1e-38 Identities = 111/121 (91%)
MicF RNA Fold:
K.pneumoniae
Salmonella
E.coli
OmpF gene :
E.coli
OmpF secondary structure:
Conserved
region
DicF RNA and FtsZ gene:
The blast results show no homology between DicF and other
bacteria.
FtsZ gene:
The gene is highly conserved in bacteria. It plays an important
role in cell division.
Score = 1379 bits (717), Expect = 0.0
Identities = 1007/1152 (87%)
E.coli
Possible directions for future research:
1) Analyze other antisense RNA molecules of E.coli and their
conservation in other bacteria.
2) Look for homology between antisense in E.coli and other
organisms (not only bacteria) in the molecules that we examined.
3) Comparison of the conserved regions and RNA-RNA interaction
regions between different antisense molecules in bacteria.
4) Searching for evolutionary motifs in antisense RNA.