Transcript Our Test Organism

Our Test Organism
Drosophila simulans
Trait of Interest
• Red vs. White
What did we do in lab 1?
• Vial of 5 white-eyed females
• Vial of 6 males, 5 white-eyed
– With ONE red-eyed male mixed in
– What is p(red-eye allele)?
• 1/11
• What did we say about the fitness of the redeyed mutant?
— Sensory perception
— Should be more fit because has better vision
— White eyes = reduced mate tracking
What should we expect to see?
• More or less red-eyed flies?
• So we have an adaptive allele (red-eyed
mutation)…
– Should increase in frequency.. What is this called?
• Selective sweep
– What about polymorphisms located near it?
• Hitchhiking
• How can we tell if a sweep and hitchhiking has
happened?
Genotype the flies near that gene!
• Need to first get DNA from the flies
(DNA Isolation)
Ahhh! Help
meeeeeee
– Squish flies to release all their DNA
• Need to look at polymorphisms near that gene
– Polymerase Chain Reaction
• Amplify the DNA of interest enough so we can look at it
on a gel
Drosophila chromosome
What are we going to look at?
• Two markers on X-chromosome
o One close to the gene for white eyes
o One far from the gene for white eyes
• Why are we going to look at 2 markers?
Red / White22 million bases of DNA
eye color gene
22 million bases of DNA
“Near”
“Far”
Polymorphisms
Recombination Hotspot!
• Red: gene mutated to give flies red-eyes
• Blue: indel polymorphism
– What is an indel polymorphism?
– NEAR marker
• Yellow: indel polymorphism
– FAR marker
Recombination Hotspot!
• Who is linked to the red gene?
– Blue or yellow?
• Say that 1 red-eyed male in the first lab had:
– Insertion at the near marker (blue)
– Deletion at the far marker (yellow)
• All white-eyed individuals had:
– Deletion at the near marker (blue)
– Insertion at the far marker (yellow)
• What will our flies today look like at each marker?
Hypothesis
• As chromosomes are passed down over generations, they sometimes
“trade pieces” with other chromosomes... (recombination)
• More likely to keep the same close neighbor gene variants than far
away neighbors.
• If natural selection makes one
variant spread quickly, its
close neighbor variants may
also spread.
This is called genetic hitchhiking
Selective Sweep
(positive directional selection)
# sites
# sites
Advantageous
mutation
1 2 3 4
Frequency in sample
1 2 3 4
Frequency in sample
Selective Sweep/Hitchhiking
Before sweep
After sweep
This is one chromosome from 12 different people. The different colors
represent different alleles for that gene.
What happened?
Selective Sweep/Hitchhiking
• If a mutation is advantageous it will likely
increase in frequency
• Why?
• What will happen to genes/traits that are
closely linked to the advantageous
mutation?
• What will happen to genes/traits that are
not closely linked to the advantageous
mutation?
Variation at 3 loci
• 2 variants at the eye color gene
– Red & White alleles
• 2 variants at the Near marker
– High and Low
– The red-eyed male from Day 1 has the high allele at Near
– The white eyed flies had both variants
• 2 variants at the Far marker
– High and Low
– The red-eyed male from Day 1 has the low allele at Far
– The white eyed flies had both variants
How are we going to observe &
measure genetic variation?
- Microsatellite Markers • Sequence differences (aka variation) between alleles
• Usually base pair repeats, insertions, or deletions
• Used for between & within-species comparisons
“Genetic markers”
Reference point in the genome with 2+ alleles
A sequence:
AACATGGTGACGGCTAGCA
a sequence:
AACATGGTGAGAGAGACGGCTAGCA
High allele
Low allele
How to tell males from females
• Males have black
abdomens
• Look close at the tip of
the male abdomen and
you will see his junk
• Females have rounded
abdomens
Female
Male
White male
Red female
White female
Red male
Sexing your flies: males have a “black butt”, females have large white
abdomen
Sexing
Female
Male
A note about contamination
• DO NOT CONTAMINATE YOUR DNA
ISOLATIONS!
– Change tips in between EACH fly squish!
– Just because you can’t see the DNA on the tip,
doesn’t mean it’s not there!