Transcript Jeopardy - TeacherWeb

Genetics Jeopardy
Mendelian Exceptions to
Mendel
Inheritance
Genetic
Disorders
Gene
Expression
Diagrams
$100
$100
$100
$100
$100
$200
$200
$200
$200
$200
$300
$300
$300
$300
$300
$400
$400
$400
$400
$400
$500
$500
$500
$500
$500
Final Jeopardy
1 - $100

The allele that is not expressed in a
heterozygous individual.

What is recessive?
1 - $200

The phenotypic ratio from a cross between two
F1 (heterozygous) individuals.

What is 3:1 (dominant:recessive)
1 - $300

Mendel’s law of inheritance that states that an
individual has an equal chance of inheriting a
dominant allele or a recessive allele from a
heterozygous parent.

What is the law of segregation?
1 - $400

The genotype of the unknown individual in a
test cross if at least one the offspring from the
cross displays the recessive phenotype.

What is heterozygous?
1 - $500

The phenotypic ratio from a cross between a
fruit fly with a grey body and red eyes
(genotype BbPp) and a fly with a black body and
purple eyes (genotype bbpp) if the genes are on
different chromosomes (not linked).

What is 25% grey/red, 25% grey/purple, 25%
black/red, 25% back/purple?
2 - $100

A cross between a red snapdragon and a white
snapdragon produces pink snapdragons.

What is incomplete dominance?
2 - $200

A person with blood type A and person with
blood type B have a child with blood type AB.

What is codominance?
2 - $300

The reason why phenotypes for traits like
height, skin color, and intelligence vary
continuously.

What is polygenic inheritance?
2 - $400

A cross between a red-eyed male fruit fly and a
white-eyed female fruit fly produces half redeyed flies and half white-eyed flies. But all the
red-eyed flies are female and all the white-eyed
flies are male.

What is sex (or X) linkage.
2 - $500

Females must inherit two copies of baldness
allele to be bald while males only need to inherit
one copy to be bald (baldness is not sex-linked).

What is sex-influenced trait?
3 - $100

Any chromosomal syndrome caused by the
inheritance of one extra chromosome.

What is trisomy?
3 - $200

A heritable condition that results in mental
retardation due to the build of the amino acid
phenylalanine in the brain. Can be controlled by
avoiding phenylalanine in the diet.

What is phenylketonuria?
3 - $300

The allele of a disorder when the affected
individual inherits it from unaffected parents.

What is recessive?
3 - $400

The probability that a female carrier for
hemophilia and a normal male will have a child
with hemophilia.

What is 25%
3 - $500

The genotype of individual II-2 on the red-green
colorblindness pedigree below (colorblindness is
sex linked recessive)

What is XRXr (or heterozygous or a carrier)?
4 - $100

Used viruses made up of radioactive phosphorus
and sulfur to determine that DNA, and not
protein, is the genetic material.

Who are Hershey and Chase?
4 - $200

The name of the group of enzymes responsible
for adding free nucleotides to a DNA template
strand during DNA replication or transcription.

What are polymerases?
4 - $300

The mRNA sequence that transcription would
produce from the DNA strand: GATTACA

What is CUAAUGU?
4 - $400

The two types of mutations that produce
frameshifts.

What are insertions and deletions?
4 - $500

The recognition sequence of the restriction
enzyme Eco R1 that produced the following
restriction fragments:
Original Strand: GAATTGGAGAATTCGATTGAATTC
Treated Strand: GAATTGGAG AATTCGTTG AATTC

What is GAATTC, cutting between G and A?
5 - $100

What is a Down Syndrome (or Trisomy 21)
karyotype?
5 - $200

What is DNA replication?
5 - $300

What is nondisjunction (during meiosis I)?
5 - $400

What is the law of independent assortment?
5 - $500

What is an autosomal recessive pedigree?
Final Jeopardy
The amino acid sequence produced by the
following DNA sequence with the additional
information.
GATCTATTATACCCCGGGGTGCATTGCA
 Promoter region is TTA
 Intron at GGGG


What is MET – GLY – THR?