Transcript PowerPoint File

Research in the Shadow of
DNA Patents
Andrew Chin
Microarray Workshop
April 5, 2002
Grant Opportunity
 North Carolina Biotechnology Center
Multidisciplinary Research Grants
 $250,000 per project
 3 different academic disciplines must be
represented
 Deadline: August 1, 2002
35 U.S.C. § 154
 A patent confers “the right to exclude others
from making, using, offering for sale, or
selling the invention throughout the United
States or importing the invention into the
United States …”
Exclusionary vs.
Exclusive Rights
 The right to exclude others from practicing
the claimed invention
• Does not give the right to practice the
patented invention if covered by third
party patent(s)
• Independent development is never a
defense (as it is with copyright and trade
secret protection)
Theories of Patents
 Incentive to invent
 Incentive to disclose
 Incentive to innovate (Schumpeter, Kitch)
 Rent dissipation theory (Grady/Alexander)
 Race to invent theory (Merges/Nelson)
 Philosophical theories of property (Locke,
Hegel)
Eligibility Requirements
 Subject Matter - § 101/100(b)
 Innovation - §§ 102/103
 Disclosure & Claims - § 112
 Utility - § 101
Patentable Subject Matter
35 U.S.C. § 101
Whoever invents or discovers any new
and useful process, machine,
manufacture, or composition of matter,
or any new and useful improvement
thereof, may obtain a patent therefor,
subject to the conditions and
requirements of this title.
New Uses
35 U.S.C. § 100(b)
The term “process” means process, art or
method, and includes a new use of a
known process, machine, manufacture,
composition of matter, or material.
§ 101: Statutory Subject
Matter
 Statutory Subject Matter
– Process (“Method”)
• Including new uses
– Machine (“Apparatus,” “Device,” or
“System”)
– Article of manufacture;
– Composition of matter; or
– Improvement on any of above.
§ 101: Non-Statutory
Categories
 Laws of nature (E = mc2; F = ma)
 Natural phenomena (gravity, lightning)
 Scientific principles (Archimedes Principle,
Pythagorean Theorem)
 Abstract (unapplied) ideas (binary to BCD
conversion)
 Methods of doing business (investment
partnerships)
§ 102: Novelty
 Must be the first inventor
– First to invent (U.S.)
– First to file (Rest of World)
 Invention = Conception + Reduction to
Practice
§§ 102/103: Prior Art
 Prior to applicant's invention date:
– Printed publications - anywhere - §102(a)
– Public knowledge or use in U.S. - §102(a)
– Prior (non-public) inventions that are:
– Not suppressed, abandoned or concealed
&
• Diligently reduced to practice - §102(g)
• Made in the U.S.A. (or NAFTA) §§ 104, 119
Printed Publications
Books, periodicals, newspapers of general circulation
Trade catalogs, conference papers
Test: Could anyone sufficiently interested in the
subject matter of the document obtain it?
Not:
Classified government documents
Confidential corporate documents
Documents not intended for distribution and not distributed
in fact
In re Hall
Is a doctoral thesis a printed publication under
102(b)?
Yes, if it is publicly accessible.
General library practice may be relied upon to
establish an approximate time for thesis
accessibility.
Library director’s affidavit: “The dissertation
‘most probably was available for general use
toward the beginning of the month of
December, 1977.”
In re Hall
Proponent of publication bar must show
that:
prior to the critical date the reference was
sufficiently accessible, at least to the
public interested in the art,
so that such a one by examining the
reference could make the claimed
invention without further research or
experimentation.
In re Hall
An applicant has constructive knowledge
of all properly indexed, cataloged and
shelved library materials worldwide.
“Described in a Printed
Publication”

To anticipate a claim to one or more
chemical compounds, a single printed
publication must:




specifically describe a compound within the
scope of the claim
disclose a method of making the compound that
enables one of ordinary skill in the art to do so
recite at least one significant useful property
(§ 101 utility requirement need not be met)
It is not necessary that the disclosed
compound actually have been made
§ 103: Nonobviousness
 The invention as a whole
• would not have been obvious
• to a person of ordinary skill in the
relevant art
• at the time the invention was made.
§112: Disclosure & Claiming
 Sufficiency of disclosure
• Written description
• Enablement
• Best mode
 Form of claims
Significance of Claim Scope
 A claim that reads on prior art is
unpatentable.
– 35 U.S.C. § 102 (anticipation)
 A claim that reads on an accused device or
process is literally infringed.
 A claim must read on the specification.
– 35 U.S.C. § 112, ¶ 1 (written description)
§ 101: Utility Requirement
 Usually only an issue for biotech
inventions (and perpetual motion)
 Related to requirement of “practical
technological application" for software
and business methods
Research Tools
 Utility for further research is not sufficient
– Research tools (e.g. microscopes): useful
– Objects of research: not useful
• E.g.: a new class of chemicals under study as
possible cancer cures
• “A patent is not a hunting license.” Brenner v.
Manson, 383 U.S. at 536
 But lower courts have found utility based on:
– Effects in laboratory animals (In re Brana)
– Chemical intermediaries in the production of directly
useful compounds
U.S. Patent No. 6,074,816
 12. The purified preparation of claim 1
wherein the oligonucleotide comprises a
contiguous sequence of at least 8
nucleotides complementary to either strand
of the nucleotide residue sequence depicted
in FIG. 62.”).
Figure 62
Strand A has 9,185 bases, beginning with:
5’-CACTCCACCATGAATCACTCCCCTGTG
AGGAACTACTGTCTTCACGCAGAAAGCGT
CTAG….
Strand B is Strand A’s reverse complement.
Claim covers 18,356 oligonucleotides (minus
duplicates)
But there are only 48 = 65,536 possible
oligonucleotides with 8 bases!
What is Patented?
An isolated and purified DNA molecule.
Why is it Patentable?
 Statutory law
 Case law
 Patent Office Guidelines
35 U.S.C. § 101 (1952)
 Whoever invents or discovers any new and
useful process, machine, manufacture, or
combination of matter, or any new and
useful improvement thereof, may obtain a
patent therefor, subject to the conditions and
requirements of this title.
35 U.S.C. § 103 (1952)
 (a) A patent may not be obtained … if the
differences between the subject matter sought to
be patented and the prior art are such that the
subject matter as a whole would have been
obvious at the time the invention was made to a
person having ordinary skill in the art …
 (c) Patentability shall not be negatived by the
manner in which the invention was made.
Diamond v. Chakrabarty
 Claim 7:
– A bacterium from the genus
Pseudomonas containing therein at least
two stable energy-generating plasmids,
each of said plasmids providing a
separate hydrocarbon degradative
pathway.
In re Bergy
 Claim 5:
– A biologically pure culture of the
microorganism Streptomyces vellosus, having
the identifying characteristics of NRRL 8037,
said culture being capable of producing the
antibiotic lincomycin in a recoverable quantity
upon fermentation in an aqueous nutrient
medium containing assimilable sources of
carbon, nitrogen and inorganic substances.
Diamond v. Chakrabarty
(S. Ct. 1980)
 § 101 subject matter includes any
“nonnaturally occurring manufacture
or composition of matter [that is] a
product of human ingenuity.”
In re Bergstrom
(C.C.P.A. 1970)
 Isolated and purified compounds are
not “naturally occurring” if they “do
not exist in nature in pure form.”
In re Deuel (Fed Cir. 1995)
 “[T]he existence of a general method
of isolating cDNA or DNA molecules
is essentially irrelevant to the question
whether the specific molecules
themselves would have been obvious.”
Patent Office Utility Guidelines
 12/99: PTO publishes interim guidelines,
seeks public comments
 1/01: PTO responds to public comments,
publishes final guidelines
Controlling Law
(Comments 6, 12, 16, 17)
 “The USPTO must administer the laws as
Congress has enacted them and as the
Federal courts have interpreted them.”
Subject Matter and Utility
(Comments 1-4, 6, 8, 14, 23)
 An isolated and purified nucleic acid molecule is a
non-naturally occurring composition of matter,
and satisfies the §101 subject matter requirement
 Disclosure of a specific, substantial and credible
utility satisfies the §101 utility requirement
– Examples: having a role in the synthesis of a
“useful protein”; expressing the presence of a
disease
Uses of DNA Molecules
(Comment 5, 7, 9-11, 20)
 First disclosed use will support a claim to DNA molecule
as composition of matter
– Right to exclude all subsequent uses
 Subsequent nonobvious uses may support “new use”
process claims under § 100(b)
– Outcome: Blocking patents
– “When genes are treated the same as for other
chemicals, progress is promoted … because a new
chemical is made available for future research.”
Enablement
(Comment 15)
It is not necessary to disclose how
or why the molecule works.
– Newman v. Quigg, 877 F.2d 1575,
1581 (Fed. Cir. 1989)
Obviousness
(Comment 13)
 Obviousness does not depend on the amount of
work required to characterize the DNA molecule.
– See 35 U.S.C. § 103(a) (patentability shall not
be negatived by the manner in which the
invention was made).
 Correct inquiry: Would the claimed DNA
molecule have been obvious to one of ordinary
skill in the art at the time the invention was made?
Homology-Based Utility
(Comments 18, 19)
 Homology: common ancestry
 DNA sequence similarity may be
evidence of homology
 Homology may be evidence of
common utility
 PTO will judge homology-based
assertions of utility on their own merits
Well-Established Utilities
(Comments 21, 22)
 Unless a well-established utility is readily
apparent, burden is on applicant to show a
specific, substantial and credible utility.
 This showing can be made after the filing
date (e.g., by submitting prior art
references), but the original specification
must enable the utility shown.
Derwent GENESEQ Database
 Collection of patented DNA sequences
– 10 or more base pairs
 Coverage from 1981
 Feb. 2001: 1,000,000 sequences
 Feb. 2002: 2,000,000 sequences
 One patent covers 382,000 sequences
How to Stop (Some) DNA Patents
 Patents are not allowed to claim subject matter
that has been previously described in a printed
publication. 35 U.S.C. § 102(a)
 General methods of making and using
oligonucleotides of arbitrary sequence are well
known and described in the literature.
 But specific oligonucleotides are not described
in this literature, so there is no § 102(a) bar
How to Stop (Some) DNA Patents
 A § 102(a) reference must include:
– A specific description of the subject matter and
– Instructions that will enable an ordinary
practitioner to make and use the subject matter
 Not necessary to have actually made or used the
subject matter
 A single copy in a public library counts as
“publication”
 Solution: Describe 11 million DNA sequences,
and general methods of making and using them,
on a single CD-ROM
The CD-ROM
 On the Preparation and Utilization
of Isolated and Purified
Oligonucleotides
As described in U.S. Patent No.
5,808,022 (issued Sept. 15, 1998)
(William D. Huse), oligonucleotide
synthesis proceeds via linear
coupling of individual monomers in
a stepwise reaction. The reactions
are generally performed on a solid
phase support . . .
The CD-ROM
Based on the the disclosures
herein and the knowledge of a
person of ordinary skill in
the art, it will be apparent
to such a person how to make
and use an isolated and/or
purified oligonucleotide
characterized by any of the
following nucleotide
sequences:
The CD-ROM
5'-AAACACCC-3'
5'-AAACACCG-3'
5'-AAACACGC-3'
5'-AAACACGG-3'
5'-AAACAGCC-3'
5'-AAACAGCG-3'
5'-AAACAGGC-3'
5'-AAACAGGG-3'
5'-AAACCACC-3'
. . .
Anticipation of Oligonucleotide
Patents
# of 8-to-12 base
oligonucleotides
claimed
1
% of possible
claims anticipated
49.6%
2
74.6%
3
87.2%
10
99.9%
25
99.99999+%
Objections to DNA Patents
 Claimed DNA inventions are discoveries of
naturally-occurring phenomena
 Sequencing DNA is not inventive
 Gene patents block:
– Development of useful downstream products
• Clinical tests for presence of patented
sequences
– Alternative uses of DNA molecules
– Free flow of DNA sequence information
 Gene patents result in marketing of human tissues
Problem
 Discussion of these objections is now
closed
– 1952 Patent Act
– Supreme Court and Federal Circuit caselaw
– USPTO Guidelines
USPTO Utility Guidelines (2001)
 There is no legal basis for treating DNA molecules
differently from other chemical compounds as
“compositions of matter”
 One who is first to identify and promptly disclose
a specific, substantial, and credible utility for an
isolated and purified DNA molecule is entitled to
exclude others from any method of making or
using that molecule during the patent term.
– Quid pro quo: § 112 disclosure
Disclosure Requirements
35 U.S.C. § 112
 Written description
– Usually: Nucleotide sequence information
 How to make
– Usually: Nucleotide sequence information
 How to use
– “Specific, substantial, and credible” utility
– Example: Microarray probe for measuring
clinically salient gene expression
The Internal Logic of DNA
Patents
 The public gets a § 112
disclosure
– Learns how to make and use a
new and nonobvious
composition of matter
 The inventor gets a patent
– Exclusive rights to make and
use the composition of matter
for 20 years from filing of
application
 Fairness of the exchange is not to
be examined
How to Reopen the Discussion
 Grant the patent system’s premises
– DNA patents create incentives for § 112
disclosures of DNA molecules
– The public benefits because more § 112
disclosures of DNA molecules are made
 Demonstrate that the project fails on its own
terms
– A few patented DNA molecules are
sufficient to impair § 112 disclosures of
most other DNA molecules
DNA Chips
 Size: One square inch
 Capacity: 100,000-1,000,000 DNA
sequences (probes)
 “If each spot on the array involves a gene
that’s patented, you have to get licenses for
each spot.”
– Jeffrey Trent
National Human Genome Research Institute
Case Study 1:
Sequencing By Hybridization
 Use a chip containing all 4k sequences of k
nucleotides (probes)
 Hybridization reaction will identify all
subsequences of k contiguous nucleotides in
the sample
Sequencing by Hybridization
TCACAGG: { TCA, CAC, CAG, ACA, AGG}
Lysov et al.
CAC
ACA
CAG
AGG
TCA
Hamiltonian path
Pevzner
TC
TCA
CA
CAC
AC
ACA
Eulerian path
CAG
AG
AGG
GG
Sequencing by Hybridization
 A sample sequence of length o(2k) can be
reconstructed using the Pevzner algorithm
from the set of subsequences with
probability 1-o(1) (Dyer et al.)
 If (2k) of the 4k possible probes are
unavailable, this is no longer true
 Aim to show: A few probe patents will
impede sequencing of many DNA
molecules
Case Study 2:
Cluster Analysis of Gene Expression Data
 Use a chip containing probes that hybridize
uniquely to known genes
 Hybridization reaction will measure expression
of these genes in the sample(s)
 Cluster analysis can generate clinically salient
classifications
Case Study 2:
Cluster Analysis of Gene Expression Data
 If probes for highly distinguishing sets of genes
(Perou) are unavailable, diagnostics will be degraded
 If a few probes are unavailable, spurious clusters are
likely
– Missing value estimation methods (Troyanskaya)
cannot help
 Aim to show: A few probe patents will impede the
identification of probes with high distinguishing
power (a specific, substantial and credible utility)