Transcript L22 RNA, QC
Today • House Keeping –CARC? • RNA extraction, DNAse treatment • Quality Control: Bioanalyzer • Stay on schedule, breaks are for • Background • Fungal amplicons Exosap, BigDye • Physella COI phylogeny PARASITES AND SNAIL BIOLOGY DNA “identity, possibilities” phylogenetics RNA “intentions” transcriptomics CTAB Trizol gel electrophoresis nanodrop spec Bioanalyzer DNA-free, PCR rDNA/mito TA cloning, B/W screening electrophoresis direct sequencing Sequence ID (BLAST) editing + Sevilleta snails Phylogenetics GenBank submission Qiagen plasmid extraction Restriction digests M13 sequencing Primer design, walking RT-PCR gel Trizol reagent • Isolates high quality total RNA (as well as DNA and proteins) Sequential precipitation of RNA, DNA, and proteins from a single sample Maintains the integrity of the RNA due to highly effective inhibition of RNase activity • Careful! Phenol (toxic and corrosive) Guanidine isothiocyanate (irritant) ITINERARY • HANDOUT 1-7 spin at same time • 10 minutes : exosap, background – 8-11 spin at same time • 15 minutes : background – 12-14+15 incubate then spin at same time • 20 minutes : exosap, BigDye, background – 16-20-21 airdry resuspend • 5 minutes : – 21 resuspend, T1-2 incubate • 30 minutes : phylogeny – T3-6 • DEMO bioanalyzer 45 min: phylogeny and background Central Dogma of Molecular Biology Central Dogma of Molecular Biology Central Dogma of Molecular Biology DNA RNA Reverse Transcriptase (RT) Using Physella acuta to Determine the Predictive Value of Biomphalaria glabrata as a Model for Gastropod Immunity Planorbidae Gastropod Immunity B. glabrata Physidae P. acuta Immune factors -LBP/BPI -MIF -Biomphalysin -Aplysianin -PGRP -FREPs ? Septic Exposure Workflow 454 RNA-Seq reads Contig remove short contigs (<500nt) & merge assemblies in Sequencher REFERENCE TRANSCRIPTOME 12,645 contigs Baseline Targeted Analysis of Immune Factors • • The reference transcriptome assembled in silico from P. acuta RNAseq data was screened for the presence of particular immune factors, previously characterized from B. glabrata. The biological reality of in silico predicted transcripts of immune factors will be validated experimentally via (sequencing of) RT-PCR amplicons. B. glabrata Expression in Immune factors P. acuta Biomphalysin Aplysianin/Achacin PGRP LBP/BPI FREP Yes ? ? ? Yes A typical bacterium contains 0.05–0.10 pg of RNA, making up about 6% of its total weight. A mammalian cell, being much larger, contains more RNA, 20–30 pg in all, but this represents only 1% of the cell as a whole (Alberts et al., 1994). It is important to appreciate that not all of this RNA constitutes the transcriptome. The latter is just the coding RNA - those molecules that have been transcribed from protein-coding genes and which are therefore capable of being translated into protein. Most of the cellular RNA does not fall into this category because it is non-coding. Non coding RNA is more diverse than the coding RNA and comprises transcripts with a number of different functions, all of which are performed by the RNA molecules themselves. In both prokaryotes and eukaryotes the two main types of non-coding RNA are: Ribosomal RNAs (rRNAs), which are the most abundant RNAs in the cell, making up over 80% of the total in actively dividing bacteria. These molecules are components of ribosomes, the structures on which protein synthesis takes place. Transfer RNAs (tRNAs) are small molecules that are also involved in protein synthesis, carrying amino acids to the ribosome Ribosomal and tRNAs are present in the cells of all species. The other non-coding RNA types are more limited in their distribution (see Figure 3.3 ). Eukaryotes, for example, have a variety of short non-coding RNAs that are usually divided into three categories, the names indicating their primary locations in the cell: Small nuclear RNA (snRNA; also called U-RNA because these molecules are rich in uridine nucleotides), which is involved in mRNA processing (Section 10.1.3); Small nucleolar RNA (snoRNA), which plays a central role in the processing of rRNA molecules (Section 10.3.1); Small cytoplasmic RNA (scRNA), a diverse group including molecules with a range of functions, some understood and others still mysterious. NON-CODING RNA (ncRNA; e.g Yasuda J, Hayashizaki Y. The RNA continent. Adv Cancer Res. 2008;99:77-112. Volume 157, Issue 1, p77–94, 27 March 2014 Why is this good RNA? $15,000.- WHAT IS IT? •Cutting edge Lab-on-a-Chip Products Agilent Technologies developed microfluidic Lab-on-a-Chip technology. This technology utilizes a network of channels and wells that are etched onto glass or polymer chips to build mini-labs. Pressure or electrokinetic forces move pico liter volumes in finely controlled manner through the channels. Lab-on-a-Chip enables sample handling, mixing, dilution, electrophoresis and chromatographic separation, staining and detection on single integrated systems. The main advantages of Lab-on-a-Chip are ease-of-use, speed of analysis, low sample and reagent consumption and high reproducibility due to standardization and automation. •What is the detection principle of the bioanalyzer system? The bioanalyzer instrument detects biomolecules by laser-induced fluorescence. During chip preparation, a dye concentrate is mixed with a gel. With the help of the priming station (a syringe), the channels of the chip are filled with the gel-dye mix. During the chip run, the dye intercalates directly with the analytes (DNA and RNA assays) or with SDS-micelles (protein assays). When analyzing cells they need to be pre-stained with application specific dyes. DEMO Interpret BIOANALYZER results TYPICAL OUTPUT FORMAT Ratio = RN number For quality! http://www.nature.com/jid/journal/v127/n2/full/5700557a.html COI sequence >PS1COI GGTCANCNNAATCATAAAGATATTGGAACATTATATTTAATTTTTGGGATCTGGTGTGGATTGGTCGGTA CTGGTTTAAGCTTGTTAATTCGTTTGGAATTAGGAACATCTCTTGTACTGTTGGATGAACATTTTTATAA TGTAATTGTTACAGCACATGCTTTTGTAATGATTTTTTTTATAGTTATACCTATAATAATTGGAGGGTTT GGGAATTGAATAGTACCTATATTAATTGGTGCTCCCGATATAAGATTTCCTCGAATAAATAATATAAGTT TTTGACTTTTACCGCCTTCATTTATCTTATTATTATGTAGGTCTATAGTTGAGGGTGGAGTTGGAACTGG GTGAACTGTTTACCCCCCTCTATCAGGACCTGTAGCTCACTCTGGTTCATCAGTAGATCTTGCTATTTTC TCATTACACTTAGCTGGGTTATCATCTATTCTAGGTGCTATTAATTTTATCACTACCATTTTTAATATAC GTTCTCCTGGTATTACACTGGAACGAATAAGCTTATTTGTTTGATCGGTGTTAATTACTGCATTTTTATT ATTATTGTCATTGCCTGTTTTAGCAGGGGCTATTACTATACTATTAACTGATCGAAATTTTAATACTAGG TTCTTTGATCCAAGAGGAGGGGGAGACCCTATTCTATATCAGCATCTATATCTGANNATTGGTCANCANN NANNT >PS2COI ANTTGGTCNNNNNATCATAAAGATATTGGAACATTATATTTAATTTTTGGGATCTGGTGTGGCTTGGTC GGTACAGGCTTAAGCTTGTTAATTCGTTTGGAATTAGGAACATCTCTGGTACTATTGGATGAACATTTT TATAATGTAATCGTTACAGCACATGCTTTTGTAATGATTTTTTTTATAGTTATACCTATAATAATTGGA GGCTTTGGGAATTGAATAGTACCTATATTAATTGGTGCTCCCGATATAAGCTTTCCTCGAATAAATAAT ATAAGATTTTGACTATTACCCCCTTCATTTATCTTATTATTATGCAGGTCTATAGTTGAGGGTGGGGTT GGAACTGGGTGAACTGTTTATCCCCCACTATCAGGACCTGTAGCTCACTCTGGTTCATCAGTAGATCTG GCTATTTTCTCATTACACTTAGCTGGGTTATCATCTATTTTAGGTGCTATTAATTTTATTACTACAATT TTTAATATACGTTCTCCTGGTATTACACTGGAACGAATAAGCTTATTTGTTTGATCAGTGTTAATTACT GCATTTTTACTATTATTGTCATTGCCTGTTTTAGCGGGGGCTATNNCCNTACTATTAACTGATCGAAAT TTTAATACTAGGTTCTTTGATCCAAGAGGAGGGGGAGATC >PS4COI GGTCAACCAATCATAAAGATATTGGAACATTATATTTAATTTTTGGGATCTGGTGTGGATTGGTCGGTA CTGGTTTAAGCTTGTTAATTCGTTTGGAATTAGGAACATCTCTTGTACTGTTGGATGAACATTTTTATA ATGTAATTGTTACAGCACATGCTTTTGTAATGATTTTTTTTATAGTTATACCTATAATAATTGGAGGGT TTGGGAATTGAATAGTACCTATATTAATTGGTGCTCCCGATATAAGATTTCCTCGAATAAATAATATAA GTTTTTGACTTTTACCGCCTTCATTTATCTTATTATTATGTAGGTCTATAGTTGAGGGTGGAGTTGGAA CTGGGTGAACTGTTTACCCCCCTCTATCAGGACCTGTAGCTCACTCTGGTTCATCAGTAGATCTTGCTA TTTTCTCATTACACTTAGCTGGGTTATCATCTATTCTAGGTGCTATTAATTTTATCACTACCATTTTTA ATATACGTTCTCCTGGTATTACACTGGAACGAATAAGCTTATTTGTTTGATCGGTGTTAATTACTGCAT TTTTATTATTATTGTCATTGCCTGTTTTAGCAGGGGCTATTACTATACTATTAACTGATCGAAATTTTA ATACTAGGTTCTTTGATCCAAGAGGAGGGGGAGACCCTATTCTATATCAGCATCTATATCTGATATTAT TGGTCACACCANNNNTTTAA >SS1COI TTGGTCAACCAATCATAAAGATATNGGAACATTATATTTAATTTTTGGGATCTGGTGTGGCTTGGTCGGT ACAGGCTTAAGCTTGTTAATTCGTTTGGAATTAGGAACATCTCTGGTACTATTGGATGAACATTTTTATA ATGTAATCGTTACAGCACATGCTTTTGTAATGATTTTTTTTATAGTTATACCTATAATAATTGGAGGCTT TGGGAATTGAATAGTACCTATATTAATTGGTGCTCCCGATATAAGCTTTCCTCGAATAAATAATATAAGA TTTTGACTATTACCCCCTTCATTTATCTTATTATTATGCAGGTCTATAGTTGAGGGTGGGGTTGGAACTG GGTGAACTGTTTATCCCCCACTATCAGGACCTGTAGCTCACTCTGGTTCATCAGTAGATCTGGCTATTTT CTCATTACACTTAGCTGGGTTATCATCTATTTTAGGTGCTATTAATTTTATTACTACAATTTTTAATATA CGTTCTCCTGGTATTACACTGGAACGAATAAGCTTATTTGTTTGATCAGTGTTAATTACTGCATTTTTAT TATTATTGTCATTGCCTGTTTTAGCGGGGGCTANNNNCNTNCTATTAACTGATCGAAATTTTAATACTAG GTTCTTTGATCC >SS2COI NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNCGGTACAGGCTTAAGCTTGTTAATTCGTTTGGAATTAG GANNNNNNNNNNNANTATTGGATGAACATTTTTATAATGTAATCGTTACAGCACATGCTTTTGTAATGAT TTTTTTTATAGTTATACCTATAATAATTGGAGGCTTTGGGAATTGAATAGTACCTATATTAATTGGTGCT CCCGATATAAGCTTTCCTCGAATAAATAATATAAGATTTTGACTATTACCCCCTTCATTTATCTTATTAT TATGCAGGTCTATAGTTGAGGGTGGGGTTGGAACTGGGTGAACTGTTTATCCCCCACTATCAGGACCTGT AGCTCACTCTGGTTCATCAGTAGATCTGGCTATTTTCTCATTACACTTAGCTGGGTTATCATCTATTTTA GGTGCTATTAATTTTATTACTACAATTTTTAATATACGTTCTCCTGGTATTACACTGGAACGAATAAGCT TATTTGTTTGATCAGTGTTAATTACNGNANNNNTNTTATTATTGTCATTGCCTGTTTTNNNNNNNNNNNN NNNNNNNNNTTAACTGATCGAAATTTTANT Physid snails (Radix sp, Lymnaeid?) What species acuta, anatina, virgata ? Includes: Physids anatomical + sequence ID Outgroups: Planorbids and Lymnaeids Add sequences to the dataset: Physella acuta A and B COI sequence (from complete genomes), include the Radix swinhoei COI sequence (complete genome NC_026707.1), Radix sp. COI MOTU5 mitochondrion, complete genome (KP098539.1) Popsetplus.txt Align, Trim to remove primers, close relatives and achieve equal sequence length New dataset for phylogenetic analysis snailCOI.txt Root tree with outgroup “Stagnicola” or “Planorbella“ What species group do “our” physids belong to? The mitochondrial gene order of P. acuta compared to other sequenced Pulmonate. Phylogeny arranged on molecular designed tree using 18S, 16S and CO1 genes as done by Dayrat, et. al., 2001. Protein-coding and rRNA genes were color coded to emphasize gene patterns and rearrangements. Negative stand genes are underlined and remain consistent throughout Pulmonates. Dark lines indicate conserved gene regions found in P. acuta compared to B. glabrata, as considered to have a conserved mitochondrial gene arrangement. http://sunsite.ualberta.ca/Projects/Aquatic_Invertebrates/?Page=19 Freshwater pulmonate snail family-level identification based on shell morphology Lymnaeid Physid Planorbid Planorbella sp. Gyraulus sp. dextral sinistral For shells with spire, check aperture right (dextral) or left (sinistral) Planorbids have a sinistral shell, coiled in one plane, sunken spire New Mexico has several species each of Lymnaeids and Physids Shell length: Lymnaeids ≤ 2.5 cm, Physids ≤ 1 cm Planorbids include Gyraulus spp. (adults < 5 mm shell diameter) and Planorbella (Helisoma) duryi, P. (H) trivolvis (large shells) For additional info see: http://www.mkohl1.net/Lymnaeidae.html, http://www.mkohl1.net/Physidae.html, http://www.mkohl1.net/Planorbidae.html