Transcript Answers to Biotech Jeopardy

Answers to Biotech Jeopardy
 Biotechnology Test Review Questions:
 Easy
 Small, circular piece of bacterial DNA is called a ____.
 Give two examples of vectors:
 The entire collection of genes within human cells is called
the _______________.
 Difference between technology and biotechnology?
 Function of restriction enzymes?
 HGP stands for? How many base pairs in HG? How
many proteins?
 Difference between surrogate and biological mother?
 A _____________ is caused by a defective or mutant
gene.
 Define gene.
 The first cell created by sexual reproduction is called a
• Biotechnology Test Review Questions:
• Easy
• Small, circular piece of bacterial DNA is called a ____.
• Give two examples of vectors:
• The entire collection of genes within human cells is called
the _______________.
• Difference between technology and biotechnology?
• Function of restriction enzymes?
• HGP stands for? How many base pairs in HG? How
many proteins?
• Difference between surrogate and biological mother?
• A _____________ is caused by a defective or mutant
gene.
• Define gene.
• The first cell created by sexual reproduction is called a
 Medium
 1. Inserting unrelated pieces of DNA together will
result in ____________________.
 2. IVF stands for? What is a synonym used for
IVF?
 3. What does transgenic mean?
 4. Identical twins are considered to be genetic
___________.
 5. How does IVF work? What does the female
have to do? What does the male have to do?
 6. Why does IVF sometimes result in twins, triplets,
or quads?
 7. Difference between fraternal vs. identical twins?
 8. How does Gel Electrophoresis separate DNA
fragments?
 9. What is an example of a genetic disease?
 10. What kind of ethical questions arise from IVF?
• Medium
• 1. Inserting unrelated pieces of DNA together will
result in ____________________.
• 2. IVF stands for? What is a synonym used for
IVF?
• 3. What does transgenic mean?
• 4. Identical twins are considered to be genetic
___________.
• 5. How does IVF work? What does the female
have to do? What does the male have to do?
• 6. Why does IVF sometimes result in twins, triplets,
or quads?
• 7. Difference between fraternal vs. identical twins?
• 8. How does Gel Electrophoresis separate DNA
fragments?
• 9. What is an example of a genetic disease?
• 10. What kind of ethical questions arise from IVF?
• Disease Huntington’s disease, sickle cell
anemia, cystic fibrosis
• Ethical questions
– Will anyone be harmed?
– What will be done with the extra embryos?
– Who will pay the cost?
– Do all involved parties agree?
– Is it safe for the mother and embryo?
 Difficult
 What is the difference between gene therapy and
genetic engineering?
 Difference between a hybrid and chimera?
 Steps of genetic engineering?
 The Hind R1 restriction enzyme is used to slice
DNA at the GAATTC between the G and C.
Illustrate how this enzyme would precisely cut the
fragment:
 ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA
 TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT
 What research can be done using gel
electrophoresis?
• Difficult
• What is the difference between gene therapy and
genetic engineering?
• Difference between a hybrid and chimera?
• Steps of genetic engineering?
• The Hind R1 restriction enzyme is used to slice
DNA at the GAATTC between the G and C.
Illustrate how this enzyme would precisely cut the
fragment:
• ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA
• TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT
• What research can be done using gel
electrophoresis?
• Hybrid has DNA from 2 organism in each
cell
• Chimera has cells from different
organisms in the body