Transcript Slide 1
PV92 PCR Alu insert, PV92 locus, chromosome 16 What can you do with the Chromosome 16 PV92 PCR kit ? • Introduce the polymerase chain reaction (PCR) technique • Apply PCR to population genetics • Directly measure human diversity at the molecular level • Compare results to published data online What is PCR? • DNA replication gone crazy in a tube! • Makes many copies of a specific target sequence from a small amount of template DNA • Affects gene mapping and cloning and DNA sequencing and detection • Applications in the detection of specific mutations, criminal investigations, and the human genome The target sequence… • Your DNA!!!! • Only Chromosome 16: Out of 23 total • Only the Alu insertion at the PV92 locus: A 600 base pair region out of over 3 billion in your total genome! • Key PCR Concepts: – Small amount of template DNA – Target specific regions of DNA – Fast results Human Cheek Cell Chromosome 16 Chromosome 16: In metaphase Histones Base Pairs DNA Double Helix PV92 Alu insert • A member of Alu repeat family – Repetitive sequences make up almost half of the human genome, Alu repeats are just one kind – This is a Ya5 Alu insert: Subfamily members by diagnostic substitutions or sequence mutations accumulated over time, JSY • 306 base pair segment of DNA, Classified as a SINE (Short Interspersed Repetitive Element) • Named for the Alu I restriction site within the sequence • Human-specific Alu insertion • Approx. 1 million Alu copies per haploid genome = 11% of the genome: role in genetic architecture and genetic disorders • Intron: Found in a non-coding region of your DNA NOT diagnostic for any disease or disorder! Alu sequence • GGCCGGGCGCGGTGGCTCACGC CTGTAATCCCAGCACTTTGGGAGG CCGAGGCGGGCGGATCACGAGGT CAGGAGATCGAGACCATCCCGGC TAAAACGCTGAAACCTCGTCTCTA CTAAAAATACAAAAAATTAGCCGGG CGTAGTGGCGGGCGCCTGTAGTC CCAGCTACTTGGGAGGCTGAGGC AGGAGAATGGCGTGAACCCGGGA GGCGGAGCTTGCAGTGAGCCGAG ATCCTGCCACTGCACTCCAGCGTG GGCGACAGAGCGAGACTCCGTCT CAAAAAAAAAAAAAAAAAAAAAAAA A • 306 base pairs long: This sequence remains the same, no matter where it is found in the genome Alu as a Mutation • Amplified in primate genomes through RNA-dependent mechanism, retroposition • Approximately one insertion every 200 new births – What does that mean???? • Contribute up to 0.4% of human genetic diseases – Inserts within genes, 0.1% – Unequal homologous recombination events between Alu repeats, 0.3% – Hypercholesterolemia, α-thalassemia, BRCA1-related breast cancer Retroposition • Transposition: Movement of gene from one chromosome to another or movement from one site to another; does not require homology • Transposons: mobile genetic elements that enable genes to move between non-similar sites • Retroposition: Creates genetic diversity • Retroposons: Replicate and move to other sites on DNA through an RNA intermediate Retroposon RNA polymerase Retroposon mRNA Reverse transcriptase Retroposon DNA Integration Protein Original Retroposon Duplicated retroposon Homologous Recombination • Parent DNA duplexes align at similar sequences and new DNA is formed by breaking and joining of homologous sequences. • RecA protein (ATPpowered) mediated through catalyzing strand exchange • Key role in DNA repair Introns vs. Exons • Introns are noncoding segments of DNA and remain “inside” the nucleus • Exons are segments of DNA that code for proteins and they “exit” the nucleus Evolutionary Significance of Alu • Some inserts are recent enough that they remain polymorphic • Highly conserved • Inserted in the last 1,000,000 years • Used in population genetics, paternity analysis, and forensics – Ancestral state known to be absent of Alu insertion – Alu insert reflects a single, unique event in human evolution PCR Results • The PV92 Alu is dimorphic so there are two possible PCR products: – 641 bp No insertion: 641 bp Alu insertion: 941 bp 641 bp – 941 bp 300 bp Alu insert Possible Genotypes? • Each gene locus has a Chromosome 16 particular form of the gene, or Homologous Chromosomes allele • What are the possible alleles for the Alu insert at each locus? +, Alu present -, Alu not present • What are the possible genotypes for the Alu insert for any given person? PV92 Homozygous positive: +/+ Homozygous negative: -/Locus Heterozygous: +/- DNA Replication in Eukaryotes http://www.johnkyrk.com/DNAreplication.html What is needed for PCR? • Template (the DNA you want to amplify for the study) • Sequence-specific primers flanking the target sequence Forward Reverse • Nucleotides (dATP, dCTP, dGTP, dTTP) • Buffer, containing salt • Taq polymerase • Magnesium chloride (enzyme cofactor) How does PCR work? • Heat (94oC) to denature DNA strands • Cool (60oC) to anneal primers to template • Warm (72oC) to activate Taq polymerase, which extends primers and replicates DNA • Repeat multiple cycles View the molecular structure of DNA (see the 5’ to 3’ structure): http://207.207.4.198/pub/flash/24/menu.swf Denaturing Template DNA Heat causes DNA strands to separate 5’ 3’ 3’ 5’ Denaturation of DNA at 94oC 5’ 3’ 3’ 5’ Annealing Primers • Primers bind to the template sequence • Taq polymerase recognizes double-stranded substrate 5’ 3’ 3’ 5’ Primers anneal at 60oC 5’ 3’ 3’ 5’ 3’ 5’ 3’ 5’ Taq polymerase extends….. • Taq polymerase extends primer • DNA is replicated 5’ 3’ 5’ 3’ 3’ 5’ Extend at 72oC 3’ 5’ 3’ 3’ 5’ 5’ Repeat denaturing, annealing, and extending 40 cycles The exact-length target product is made in the third cycle: 5’ Cycle 1 Cycle 2 Cycle 3 3’ 5’ 3’ 5’ 3’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ View the PCR reaction at the Dolan DNA Learning center: http://www.dnalc.org/ddnalc/resources/shockwave/pcranwh ole.html PV92 locus sequence with Alu • AACTGGGAAAATTTGAAGAGAAAGTCACACAGATACAT TTCAGTAAGGTTGTCTCTGTTACTTGAGGCTTACAAGAA GGAAAGAAGGCCGGGCGCGGTGGCTCACGCCTGTAAT CCCAGCACTTTGGGAGGCCGAGGCGGGCGGATCACG AGGTCAGGAGATCGAGACCATCCCGGCTAAAACGCTG AAACCTCGTCTCTACTAAAAATACAAAAAATTAGCCGGG CGTAGTGGCGGGCGCCTGTAGTCCCAGCTACTTGGGA GGCTGAGGCAGGAGAATGGCGTGAACCCGGGAGGCG GAGCTTGCAGTGAGCCGAGATCCTGCCACTGCACTCC AGCGTGGGCGACAGAGCGAGACTCCGTCTCAAAAAAA AAAAAAAAAAAAAAAAAAGAAAGAATTCCCTCTCTAAAC ACACTCTAACACACAGGAGTTGAGAACTCA • Where would your primers be if you were looking for this alu insert anywhere in the genome? • Where would your primers be if you were looking for only the alu insert at the PV92 locus? Actual Alu PCR Results + - +/- 941 bp 641 bp + - +/- PCR Procedures Day 1 Day 2 Day 3 Day 4 Genomic DNA Extraction • InstaGene = Chelex® cation exchange resin; binds cellular MgCl2 • 56oC loosens connective tissue and inactivates DNases • 100oC ruptures cell membranes and denatures proteins InstaGene Extraction Cell membrane Nuclear membrane Mg++ Genomic DNA Mg++ Mg++ Heat disrupts membranes Mg++ Mg++ Mg++ InstaGene matrix binds released cellular Mg++ Extensions • Making DNA probes • Gene expression studies • Detection of viral pathogens or bacterial infections • Genetic diagnoses • Crime scene investigations • Anthropology • Key words: minimal template and FAST Microbial Diagnostics • RFLP (a): Banding patterns are compared to reference strains • PCR (b): sensitivity allows small sample size and early detection; clinical microbiology diagnostics and microbe infections • DNA sequencing (c): Microbes affecting public health (76 million cases of foodborne disease causing over 300,00 hospitalizations per year in the US DNA Fingerprinting • MLP’s (20-30 bands) ensure identification: 1 in 30 billion chance of a match between individuals • In the United States, the FBI incorporates 13 sites on average into its profiles. With 26 different bands studied, you'd be incredibly hard pressed to find two unrelated individual with the same DNA profile; the odds of a match in this case are well more than one in a hundred billion. The bottom line is that, unless you have a twin, you're statistically two thousand times more likely to win the Publisher's Clearinghouse sweepstakes (1 in 50,000,000) than to have a DNA profile that matches anyone else. • http://www.dnai.org/d/index.html