Transcript YARN MODEL OF DNA/GENES/CHROMOSOMES

YARN MODEL OF
DNA/GENES/CHROMOSOMES
The yarn represents DNA.
DNA is a tiny, long, thin chemical.
How does the yarn resemble DNA?
If we looked closely at the
DNA inside each of your cells,
it would look like a twisted ladder.
Sort of like this…
Look again
at the yarn.
How does the yarn
remind you of DNA?
Did you notice the letters
in the image of DNA?
What are the four letters?
These four
substances
are what allow
DNA to be
a type of
chemical code.
Putting them together, you
might get something like this…
You’ve seen codes before.
Look at this code:
19-3-9-5-14-3-5 18-15-3-11-19
Anyone know what
this code says?
Decoded, it means….
Science Rocks!
(A=1, B=2, etc.)
DNA carries the information
(the code) that tells your
cells how to make traits.
This code, for example…
ATTCGTAAACGCGAATTGCTCA
GATTCGTAAACGCGAATTGCTCAG
might give you dark eyes.
What are some
examples of traits?
Eye color
Can Roll Tongue
Cannot Roll Tongue
Genes
A section of code (DNA) that
gives information for building
a single trait is called a GENE.
On your yarn, the different colors
represent different genes.
Perhaps the green section
has the code for eye color.
Maybe the pink section has
the code for earlobe shape.
How many different
genes do you have
on your yarn DNA?
On real DNA you
might have hundreds
of genes since real
DNA is very, very long.
Sometimes these long,
loose strands of DNA
need to get organized.
For example, this
happens before cells divide.
Organized DNA is
called a chromosome.
Your next task is to
create a chromosome.
Hold one end of the yarn DNA
against the popsicle stick and
carefully wind the yarn DNA
around the stick in a single layer.
Now, you have a chromosome.
Are the genes still there?
How do you know?
What are genes made of?
How does your
model compare
to this actual
CHROMOSOME?
This is really
a duplicated
(or doubled)
chromosome.
Summary Questions:
What part of this model
represents DNA? Genes?
Compare and Contrast DNA before
and after it is in a chromosome.
Which do you think is
easier to see in a microscope loose
DNA or DNA organized into
chromosomes? Why?
DNA strands lying between 2 silicon pillars. 12/3/12
Fact First Questions:
The yarn represents DNA.
Explain how yarn and DNA are
similar.
The yarn colors represent genes.
How are the yarn colors and
genes related?
DNA is a chemical code made up
of 4 substances: A, T, C, and G.
How is the DNA chemical code
used?
Chromosomes are formed
when DNA gets organized.
Explain the advantages of DNA
creating chromosomes.