Transcript 160314 - SunPM - PMcKenzie

The problem with human evolution …
So God created man in his own image, in
the image of God created he him; male
and female created he them. Gen 1 : 27
?
Where did the monkey come from ?
Starting at the beginning
Starting at the beginning
What is life ?
can it be understood in material terms?
What is life ?
All living organisms are said to have the
following characteristics:
 Able
to live independently of parent
 Has a metabolism that requires energy
 Produces offspring identical to itself
 Has DNA or RNA for reproduction
 Molecules that have ‘chirality’
 Has a cellular structure
The important question
Is it possible for living
matter to originate from
inert matter ?
This is also known as spontaneous
generation or abiogenesis.
st Cent. BC
1
Spontaneous Generation
The early Greek philosophers such
as Anaximander, Aristotle and
Lucretius believed that living
organisms originated from mud
heated from the sun.
Your serpent of Egypt is bred now
of your mud by the operation of
your sun: so is your crocodile.
Antony and Cleopatra: Act 2, written before the spring of 1608
On the Nature of
Things By Lucretius
Written 50 B.C.E
Spontaneous Generation
1500s
... if you press a piece of underwear
soiled with sweat together with some
wheat in an open mouth jar, after about
21 days the odour changes and the
ferment coming out of the underwear
and penetrating through the husks of the
wheat, changes the wheat into mice.
Flemish scientist
Jan van Helmont
(1580-1644)
Spontaneous Generation
1500s
But what is more remarkable is that mice
of both sexes emerge (from the wheat)
and these mice successfully reproduce
with mice born naturally from parents ...
But what is even more remarkable is
that the mice which came out were not
small mice… but fully grown.
Flemish scientist
Jan van Helmont
(1580-1644)
Spontaneous Generation
1600s
In the seventeenth century Italian
scientist Francesco Redi through
experimentation developed the
doctrine of “omne vivum ex vivo”
All life comes from pre-existing life
Italian scientist
Francesco Redi
(1626-1697)
Spontaneous Generation
Erasmus Darwin proposed a
modified theory of spontaneous
generation in which only the
simplest life forms spontaneously
generated from which higher order
life forms were derived.
Organic life began beneath the waves.....
Hence without parent by spontaneous birth
Rise the first specks of animated earth;
From nature's womb the plant or insect swims,
And buds or breathes with microscopic limbs."
Temple of Nature by Erasmus Darwin
1700s
Erasmus Darwin
(1731-1802)
Organic life beneath the shoreless waves
Was born and nurs'd in ocean's pearly caves
First forms minute unseen by sphearic glass
Move on the mud, or pierce the watery mass;
These, as successive generations bloom,
New powers acquire and larger limbs assume;
Spontaneous Generation
1800s
In the nineteenth century, famous
French scientist Louis Pasteur entered
the debate and through experiments
proved that the supposedly
spontaneously generated life forms had
in fact come from micro-organisms
which abound in the atmosphere.
French chemist
Louis Pasteur
(1822-1895)
The primordial soup myth
Spontaneous generation
having been disproved, the
battle field was moved to a
time in the supposed
primordial earth, when
conditions were more
favorable to the generation
of life.
1900s
Russian biochemist
Aleksandr Ivanovich Oparin
(1894-1980)
The primordial soup myth
“Life arose on earth thousands of
millions of years ago when
collections of organic molecules in
the primeval soup which formed in
the primitive ocean became isolated
from the bulk water of that ocean.
Because of their closeness these
molecules were able to interact with
one another and began to show the
first signs of life.”
E.J. Wood and W.R. Pickering, Introducing Biochemistry (1982) p. 17
1900s
Heat for 1 million years and add lightning bolt
The primordial soup myth
1900s
The Miller Experiment
The most generally respected
study on the origin of life via
a primordial soup is the
experiment conducted by the
American researcher Stanley
Miller in 1953.
1900s
The Miller Experiment
1900s
4 key problems with this experiment:
Used a “cold trap” to isolate the amino acids from the
environment as soon as they were formed.
 Unrealistic atmosphere simulated. Scientists now
agree that nitrogen and carbon dioxide are required.
 The atmosphere should also have had oxygen, which
would have destroyed the newly formed amino acids.
 Other organic acids also formed that were detrimental
to the structure and function of living things.

Millers Experiment
1900s
If I can just synthesize life here,
then I’ll have proven that no
intelligence was necessary to
form life in the beginning
The primordial soup myth
1900s
“It was popular not because there was any
evidence to support it, but because it
seemed to be the only alternative to Biblical
creationism.”
Physicist Freeman Dyson
“It is remarkable that over the past halfcentury the scientific world has, almost
without exception, believed a theory for
which there is not a single supporting fact.”
Sir Fred Hoyle
Molecular Chirality
all molecules are not created equal
Molecular chirality
The building block amino
acids of all living things are
100% left handed.
However, a hypothetical
‘soup’, by well-known laws of
chemistry, would inevitably be
an even racemic mixture of
left and right-handed acids.
Sarfati, J., The origin of life: the chirality problem, CEN Technical Journal12(3):281-284, 1998
Extra-Terrestrial Life
move the problem somewhere else
400 to 54 million km from earth
Life from Mars?
The Moon : LIFELESS !
400 000 km from earth
If life could not have started
on Earth, it must have come
from somewhere else – right ?
Electron micrograph of Martian meteorite ALH84001




Magnetosphere filtering out
lethal solar radiation
Atmospheric gases of the
exactly the right ratio
Earth tilted at a angle of 23°
giving us our seasons
Position in relation to the gas
giant planets and asteroid belt
The distance from and the
tidal effect of the moon
 Located within the
Habitable Zone (HZ)

Life on Earth ?
Add 154 other factors!
The chemistry of life
how to build a human
Elements - Atoms
Nitrogen
Hydrogen
Oxygen
Carbon
Phosphorus
If the nucleus of a typical atom were expanded to
the size of a basket ball, the atom would be about a
3 km in diameter. Atoms are mostly empty space!
Molecules
Amino Acids
Adenine
Cytosine
Guanine
Sugars
Thymine
All amino acid molecules in DNA are left
handed chiral molecules
DNA and RNA also use pure righthanded chiral sugar molecules
DNA - Deoxyribose Nucleic Acid
DNA is such an
incredibly complicated
molecule that it is over
six feet in length !
In a human being, each cell
holds 46 separate DNA
molecules, each containing,
on the average, about 160
million nucleotide pairs, yet
this massive amount of
information is stored and
replicated almost flawlessly.
Nitrogen
Hydrogen
Oxygen
Carbon
Phosphorus
Genes
Adenine + Thymine
Thymine + Adenine
Cytosine + Guanine
Guanine + Cytosine
The base pairs of amino
acids act like a structural
integrity test.
Because only A & T join
and C & G join, the two
sugar backbones that
make the DNA double
helix are identical but in
verse order.
This ensures that in the
case of a single amino
acid being wrong the
whole double helix
structure is invalidated.
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
TAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGC
Chromosomes
All humans have 23 pairs of chromosomes. 22
regular pairs and an XY pair. Chromosomes exist
in the nucleus of all of our 100 trillion cells and are
essential discreet sections of the genetic code.
Cells
s
Some life forms are
made of only a
single cell
Cells are where the atoms and molecules
begin to demonstrate specific purpose and
functional objectives – the first real evidence
of intelligence
The two most important cells
s
Human Foetus
s
As thou knowest not
what is the way of the
spirit, nor how the
bones do grow in the
womb of her that is
with child: even so
thou knowest not the
works of God who
maketh all. Ecclesiastes 11:5
A human life at about 12 weeks
I will praise thee;
for I am fearfully
and wonderfully
made: marvellous
are thy works; and
that my soul
knoweth right well.
Psalms 139:14
The Last Word
what has God said …
The invisible things …
Romans 1:20 For the invisible
things of him from the creation of
the world are clearly seen, being
understood by the things that are
made, even his eternal power and
Godhead; so that they are without
excuse:
Professing themselves to be
wise, they became fools …