Transcript Translation and Protiens

Who knows the code? - Take one
 What happens if a tRNA carries the wrong
amino acid?
 What happens if the mRNA contains a copy
error relative to DNA?
 What happens if a tRNA has a mutated
anticodon
Choreographing translation


A play of many parts,
many players
Let us do this quickly!
But a reminder…
Roles
 4 tRNA (1-2 people)
 4 teams to be synthetases (1-2 people)
 1 group to be the ribosome (~3 people)
 1 group to be (RNA polymerase + mRNA)
(~3 peeps)
 1 termination factor (1-2 people)
Learning your ‘lines’
 Handout: Each group find the questions
related to their role and answer them
 Lab manual, textbook, internet OK as sources
 Meet your blocks-- 5’ is the end that sticks to
hair, socks, shirts…
DNA template strand
5’ CTTAAATCCGAATGCCCATG 3’
DNA template strand
(alternate version)
5’ CTTAAATCCGAATGCCCATG 3’
Special powers
 Recall that ribosome assembly is the result of
methionine tRNA finding a match on mRNA
in presence of small ribosome subunit
 Only methionine tRNA (it will ‘know itself ’
once crowned by the synthetase that hands
out met) can inspect ALL of the mRNA and
help ribosome to assemble
Going with the flow
 mRNA at the central bench

ribosome assembles around it
 synthetases at bench corners (or ‘diffuse’ opp.
direction vs. tRNA)
 tRNAs will ‘diffuse’ by following a path through the
room
 When any event first happens*, action stops,
molecules involved will announce, explain
 Go until a protein happens
*This includes non-events (rejections, etc.)
Who knows the code?
 What happens if a tRNA carries the wrong
amino acid?
 What happens if the mRNA contains a copy
error relative to DNA?
 What happens if a tRNA has a mutated
anticodon
First some lovely terminology - Nucleic
Acids
 Monomer: nucleotides (pentose sugar
+ phosphate + purine/pyrimidine base)
Nucleic Acids

Primary Biological Function: information
storage
cellbio.utmb.edu/cellbio/ribosome.htm
Proteins

Amino acids are linked together by peptide
bonds to form one or more macromolecule
subunits called polypeptides. Long chains of
polypeptides result in the formation of proteins.
The primary amimo acid sequence of a protein
determines its secondary, tertiary, and quaternary
structure, which then in turn determines its
functional state.
Or yet to say it another way



It’s important to note that each amino acid in
the chain can be thought of having certain gross
chemical features. For example, these may be
hydrophobic, hydrophilic, or electrically charged.
These variables interact with each other and
their surroundings in the cell to produce a welldefined, three dimensional shape.
The native state of a protein refers to it’s
functional or operative form.
Proteins


Monomer: AMINO ACIDS
Covalent Bond: PEPTIDE BOND
Proteins

Primary Biological Functions: NUMEROUS
INTRACELLULAR ROLES; CATALYSIS
(speeding up chemical reactions)
Proteins

Key Examples: enzymes (catalysts); membrane
transporters (bind and allow passage of certain
molecules into cells); signaling proteins
You should know…



Protein folding, oil not mixing with water, and
membrane formation all reflect the same
principle
In protein folding, the constraint is that the
individual units are all attached to a pair of
neighbors
Many proteins need no further ‘instruction’
than their sequence & water to correctly
assume their superhero identity
Proteins & structure
Essential biology, 2nd ed.
Proteins

Proteins denatured by
heat, alterations in
pH, or certain
chemicals lose
tertiary and
secondary structure.
Proteins
•
•
Oxygen reversibly bound to hemoglobin in red blood cells
Each molecule of hemoglobin can carry a maximum of
four molecules of O2
Helix, Sheet, Thinking
Protein folding images in 3D
Proteins
•Affinity of hemoglobin for O2
depends on PO2 to which
hemoglobin is exposed
•hemoglobin picks up O2 as it
flows through respiratory
exchange structures and gives
up O2 in metabolically active
tissues
•The affinity of hemoglobin for
O2 is decreased by the
presence of hydrogen ions or
metabolites of glycolysis
Proteins
• Myoglobin has a high affinity
for O2 and serves as an O2
reserve in muscle
• Fetal hemoglobin has a
higher affinity for O2 than
does maternal hemoglobin,
allowing fetal blood to pick up
O2 from the maternal blood in
the placenta
Proteins
•Sickle cell anemia = 2
hydrophobic spots (one arising
via mutation) get stuck together
in presence of water
•New sticky spots make
hemoglobins form GIANT
chains; these deform RBC,
reduce their flexibility, and cause
them to get trashed in tiny
vessels, loss of too many RBC
=> not enough O2 transport =
anemia. Bad news!!!
www.defiers.com/scd.html
Seventy Great Mysteries of the Natural World Thames & Hudson p. 112
The real
structure –
Beautiful !
Seventy Great Mysteries of the Natural World Thames & Hudson p. 112
Hemoglobin tutorial
 Read the instructions on the intro...
 Read the instructions on each question...
 Read the instructions on the webpage...
 Read all the words of each question...
 ... or gnash your teeth in frustration & futility!
Different tools; different jobs
 Your group has an amino acid; which is it?
 In what ways are all bases identical? Different?
 In what ways are all amino acids identical?
Different?
 Which group is more diverse in terms of ‘feel’?
 Which is more diverse in terms of shape?
 Which would allow you to build more diverse
shapes & surfaces?
Homework for next week


Assessor: “Chimeric Dictyostelium Paper”
Same deal as before – find the paper and read
(or scan) it. Do the assignment before next class.
More paper fun!

Introduction to the scientific literature

It really is important that you know how to
navigate one of these things, besides – it’s
probably one of the easier Assessor type
assignments! (if there is possibly such a thing)
Why read ?
 Rather than always reproducing everything ever
done, past work is filtered and ‘accepted’
 Accessing this body of knowledge can be a
source of inspiration, insight, inquisitiveness
 buyer beware: both the writing and the
reviewing of papers is done by real people with
the requisite strengths & weaknesses
For 181 Lab
 A paper about an organism that you
will be experimenting with
 An introduction to the biology and
study of the organism
 A homework assignment requiring
you to read, understand