Transcript DNA Technology

In This Lesson:
DNA Technology
(Lesson 3 of 3)
Today is Friday (!),
January 20th, 2017
Pre-Class:
We learned what DNA is.
We learned what DNA does.
What can we do with DNA?
Today’s Agenda
• DNA Technology
– Transformation
– PCR
– Gel Electrophoresis
• Restriction mapping
• Where is this in my book?
– Chapter 20.
By the end of this lesson…
• You should be able to describe several uses for
modern DNA technology in today’s society.
• You should be able to run a gel
electrophoresis.
• You should be able to direct bacterial
transformation.
So what’s with the glowing animals?
• You’ve heard it before in one of those
TED talks we listened to – we’ve
entered the genetic engineering era.
• Now that we’re getting pigs and
rodents to express bioluminescent
genes from jellyfish, we clearly have
made some advances in the
technology realm, too.
It begins with bacteria...
• …because it always begins with bacteria.
• Here are the things you need to know:
– They grow rapidly.
• Like, “a new generation every 20 minutes” rapidly.
• Like, “a 100,000,000 bacteria colony overnight” rapidly.
– They are the most dominant form of life on Earth.
– They reproduce by binary fission – not mitosis.
• Even more important to DNA tech is…their DNA.
Bacterial DNA
• Bacterial DNA takes the form of a single,
circular chromosome.
– They are therefore haploid – one chromosome
total.
– There are no histone proteins, so they have naked
DNA.
– They have approximately 4 million base pairs,
making up about 4300 genes.
• This is around 0.1% of eukaryotic DNA.
Bacterial DNA
• Despite being asexual reproducers, bacteria
also engage in three different forms of
“pseudo-sex” whereby they exchange DNA:
– Conjugation
• DNA is transferred between two bacteria.
– Transduction
• Viral infection by a bacteriophage virus.
– Transformation
• Bacteria take up DNA in the environment.
• Remember the Griffith experiment?
http://www.ncbi.nlm.nih.gov/books/NBK7908/
Transformation
• Transformation allows bacteria to take up
other bacterial genes.
– They import it through specialized membrane
transport proteins.
• The DNA they pick up is then integrated with
their own DNA, allowing them to express new
genes.
– This is a good reason for avoiding the overuse of
antibiotics...
• …and Purell®.
Plasmids
• Independent of the chromosome are plasmids.
– These are small, circular loops of DNA that are
generally not essential to the bacterium’s existence.
– They are self-replicating and carry additional genes.
• Between 2-30.
• Many are genes for antibiotic resistance.
• Key: Plasmids are the DNA bits exchanged in
conjugation and transformation.
Uh-huh. So?
• So where does DNA technology come in?
• The key is in the plasmids.
• Technology allows us to insert a new gene into
a plasmid, then put that plasmid into another
bacterium.
– A recombinant plasmid inserted into another
bacterium is called a vector.
• The “host” bacterium will then express those
new genes.
Bacterial Transformation
Plasmid
Cut a DNA plasmid.
Vector
Glue the DNA
Get a gene from
another organism.
Recombinant
plasmid.
Transformed
bacteria.
Bacterial Transformation
Cut a gene out.
Splice it into a
plasmid.
You now have a
vector.
Bacterial Transformation
• And uh…how exactly do we cut DNA?
• With restriction enzymes.
– Officially known as restriction endonucleases.
– Why “endo-?” Because the cuts are made within the
DNA strand, not from the end like an exonuclease.
• You’ve seen endonuclease enzymes before…
• …
• …where?
– Jog your memory with your partner.
– This will make a lot of sense.
Flashback: Unit 6 Lesson 1
DNA Structure and Replication
• Another enzyme, called a
nuclease, literally cuts the
erroneous nucleotides
out.
• Pol I then replaces the
DNA with appropriate
nucleotides.
• Ligase, as usual, steps in to
seal up the strand.
• Fun fact: Pol II appears to be
involved in error checking in
prokaryotes.
Back to Restriction Enzymes
• Restriction enzymes were discovered in the 1960s.
• They evolved in bacteria as a means of cutting up
foreign DNA.
– Thus, they restrict the activity of a possible predatory
bacterium or virus.
• How do the restriction enzymes not cut the bacterium’s
own DNA?
– The local DNA doesn’t have any of the nucleotide sequences
recognized by the restriction enzymes.
– OR, the bacterium methylates (adds methyl groups) to the A
and C in their own DNA to block the enzyme.
So what do we do with them?
• Restriction enzymes cut DNA at specific
sequences known as restriction sites.
– These are palindromic sections of DNA.
– For example, suppose we have the following
sequence:
CTGAATTCCG
GACTTAAGGC
A restriction enzyme
makes a cut:
The results are two
palindromic “ends:”
CTGAATTCCG
GACTTAAGGC
CT
GAATTCCG
GACTTAAG
GC
Palindromic DNA Sequences
• This is a little bit different from palindromes in
language.
• A palindromic DNA strand reads the same 5’ to 3’ as
its complementary strand reads 5’ to 3’.
• Here’s what I mean:
The strand reads the same
in this direction…
GAATTC
CTTAAG
…as the complementary
strand does in this direction.
Restriction Sites
• One well-known enzyme makes its cuts at this
sequence:
– CCCGGG
– GGGCCC
• Another, like we saw, cuts here:
– GAATTC
– CTTAAG
• The cuts they make are different for each
enzyme, but they always cut at the same
restriction site.
Other Restriction Enzymes
http://en.wikipedia.org/wiki/Palindromic_sequence
Ends
• Some restriction enzymes cut “across”
restriction site sequences.
• The cut leaves what look like staggered ends
of telomeres.
– We call them sticky ends.
– Unlike telomeres, they are capable of bonding
Sticky End
CT
GAATTCCG
GACTTAAG
GC
Sticky End
Ends
• Some restriction enzymes cut “straight through”
restriction site sequences.
– Not as useful for transformation but good for DNA
fingerprinting.
• This kind of cut produces blunt ends.
Blunt Ends
CCC
GGG
GGG
CCC
Creating Vectors
• So let’s say you have a gene that you want to use:
Target Gene
CT GAATTCCGAGGATCCGGCAACAGTCTGAATTCCGAGGATCCCTGA
GACTTAAGGCTCCTAGGCCGTTGTCAGACTTAAGGCTCCTAGGGACT
• Use a restriction enzyme to slice it out.
• Use the same enzyme to slice open a circular
bacterial plasmid.
ACCAGATTGCCTCTGAATTCCGAGGATCCCTGAGGCATACGATTCCCAG
TGGTCTAACGGAGACTTAAGGCTCCTAGGGACTCCGTATGCTAAGGGTC
• Add the target gene to the plasmid.
Vocabulary and Concepts
• Digestion is the process by which restriction
enzymes slice open existing DNA.
• Annealing is the process by which sliced DNA is
recombined.
– As in, the “add the target gene to the chromosome”
step.
• The sticky ends are used to bring the pieces
together.
• DNA ligase, as usual, seals up the pieces.
Why bother?
• Okay, it’s a neat trick, we can give bacteria DNA. So
what? How does that help me?
• Do you know where insulin for diabetics comes from?
– Wanna guess?
• If you guessed “insulin fairy,” you’re wrong.
• If you guessed “we grow it in bacteria by adding
human insulin vectors,” you’re right.
• Key: There is a major catch with adding eukaryotic
DNA to prokaryotes. They can’t cut out the introns.
Transformation: The Overall Process
• Insert recombinant plasmid into bacterium.
• Culture (grow) bacteria in agar.
– The bacteria keep copying the plasmid.
• Eventually, the phenotype will be transformed
and the new protein will be produced.
• You can also insert genes in this way into
other cells.
– Wanna see?
Transformation in Other Organisms
C. elegans
E. Coli
Transformation in Other Organisms
Transformation in Other Organisms
Transformation in Other Organisms
Transformation in Other Organisms
Other Uses of Transformation
• GMO (genetically-modified organisms)
• We can take advantageous genes from other
organisms and insert them into valuable crops (and
maybe animals?) to make them hardier or improve
quality.
• For example:
– BT Corn: Add a bacterial toxin that kills corn borer
caterpillars to make corn pest-resistant.
– Fishberries: Add an anti-freezing gene from flounder to
strawberries to extend the growing season.
– Golden Rice: Add genes to produce Vitamin A and enrich
the nutritional value.
• [HHMI GMO articles]
Other Uses of Transformation
• Or for something
a little more indepth…causing
GFP (green
fluorescent
proteins) to be
expressed in fish
brains to read
their thoughts.
• Cue the video!
A Way Around Transformation
• Transformation allows for some pretty cool
stuff.
• However, it’s a bit of a pain in that you still
need that “grow the bacteria” step.
• Is there a way to avoid using bacteria as
miniature gene factories?
• Yep, and it’s called PCR.
PCR
• PCR is short for
Polymerase Chain
Reaction.
– So it’s aptly named for a
process designed to
make DNA.
• Sure enough, PCR can
make lots of DNA and
needs only one cell to
start.
PCR – Ingredients
• To perform PCR, you need the following:
– A DNA sample to be amplified.
– DNA polymerase enzymes.
– Free nucleotides.
• In the form of ATP, GTP, CTP, and TTP.
– Primers.
• Short strands of synthetic DNA.
– A thermocycler, which gradually raises and
lowers the temperature of the sample.
http://surgerydept.wustl.edu/uploadedImages/Deeken_Biomaterials_Lab/PCR_Eppendorf.jpg?n=3263
PCR – How Does it Work?
1. When the temperature rises to around 90°C, the
strands separate, producing two template strands.
– The denaturation phase.
2. When the temperature cools to around 55°C, DNA
fragments (those primers) join the template strands,
much like the RNA primers made by primase.
– The joining of the primers is called annealing.
3. When the temperature rises to around 70°C, DNA
polymerase copies the rest of the strand.
– This is the extension part of the PCR cycle.
• Repeat the process for 20-35 cycles, with each cycle
taking around 1.5 minutes (30 seconds/step).
– The amount of DNA made grows exponentially higher.
PCR In One Image
PCR In One Animation
• PCR Biotechnique Animation
About Primers
• Primers define the section to be
polymerized, since DNA
polymerase only starts working
there they are.
• Because they must be added to
the PCR process, the user must
know some of the strand’s
sequence.
• Bookend the sequence of DNA
you want amplified using the
primers.
About DNA Polymerase
• Did you catch something strange about the
temperature of PCR?
– The DNA polymerase enzyme is exposed to 90°C
temperatures during the elongation phase.
– How does it not denature? 90°C = 194°F
– We’d have to add new enzymes every cycle, which
is kind of a pain in the genes…
About DNA Polymerase
• We use taq polymerase – it’s a
DNA polymerase found in
thermophilic bacteria living in
hot springs!
– The enzyme name comes from
the bacteria’s Latin name:
Thermus aquaticus.
Who Invented PCR?
• Kary Mullis, avid surfer and now a Nobel Prize
winner, invented the procedure in 1983.
• He’s also author to an exceedingly awkwardlynamed book:
http://fridge.gr/wp-content/uploads/2011/05/mullis.jpg
http://1.bp.blogspot.com/-iFylSW_BFEA/Ur2ZNyH5flI/AAAAAAAAAEE/hrZ9gCd584w/s1600/kary+mullis.JPG
Other Uses of Restriction Enzymes
• What if we digest DNA samples but don’t
recombine them in plasmids? Is it any good?
– Yep.
• If we cut up DNA from different organisms or
people and compare, we can use it for:
– Forensics
– Medical diagnostics
– Paternity
– Evolutionary relationships
– Other?
Comparing DNA
• DNA is best compared by fragment size.
• We separate the fragments by running them
through an agarose gel (made from algae).
• This is called gel electrophoresis.
Gel Electrophoresis
• So how does DNA “run” through
the gel?
– Why, electricity, of course!
• DNA is negatively charged as a
result of its phosphate groups.
• If you pass an electric current
through the gel, DNA moves to
the positive side.
-
Gel Electrophoresis
• So all DNA moves toward the positive side…how
do we tell the fragments apart?
• Key: The size of the DNA fragment determines
how far it travels.
– Small pieces electrophorese (travel) longer distances.
– Large pieces electrophorese (travel) shorter distances.
• Let’s take a look at what I mean…
Gel Electrophoresis
Digest DNA into
pieces using
restriction enzymes.
Note: Gel
electrophoresis
usually runs
horizontally
across a table,
not up and
down.
Larger pieces.
Load the DNA into
wells in the gel.
Connect each end
to a power
source.
Smaller pieces.
Gel Electrophoresis
• So we all have our differences, right?
– Wait…what differences?
• As you know, all humans have 99%+ the same DNA.
• The differences lie in the sections of “junk” DNA
between genes.
– I’m not talking about introns. This is a DNA thing.
• These junk sections, which could be segments of viral
DNA from ancient infections, vestigial DNA, or just
plain ol’ junk.
– It’s usually repeated patterns of CAT, GCC, or others.
– People have different numbers of repeats.
Gel Electrophoresis
• As a result, restriction enzymes will cut the DNA in
different locations, making different size fragments
and potentially different numbers of bands:
Restriction Sites
Sample 1
Sample 2
(one nucleotide
difference)
Sample 3
(sequence duplication)
The differences in
restriction sites
are known as
restriction
fragment length
polymorphisms.
Gel Electrophoresis: Uses
• Suppose the leftmost
well in the gel to the
left is loaded with a
DNA sample from a
crime scene.
• The others are loaded
with DNA samples
from criminals.
• Whodunit?
– “I always knew Gladys
couldn’t be trusted.”
A Little History
• In 1987, Tommie Lee Andrews
became the first person
convicted of a crime as using
DNA evidence/analysis.
– In his case, he had raped over
23 women and was convicted of
raping two using DNA.
• Fun fact: He may soon be
released.
• The gel:
http://offender.fdle.state.fl.us/offender/CallImage?imgID=1501088
Tommie Lee Andrews
A Little History: Another Case
•
Guilty?
Blood Sample 1
Blood Sample 2
Blood Sample 3
[Standard]
Suspect
Victim 1
Victim 2
[Standard]
– FYI, the
“standard” is a
sample with
known fragment
sizes for
perspective.
• Who are these
people anyway?
– It’s the OJ
Simpson murder
case (1994).
From Wikipedia on the OJ Case…
• Samples from bloody shoe prints leading away from the
bodies and from the back gate of the condominium were
tested for DNA matches. Initial polymerase chain reaction
testing did not rule out Simpson as a suspect. In more precise
restriction fragment length polymorphism tests matches were
found between Simpson's blood and blood samples taken
from the crime scene (both the shoe prints in blood and the
gate samples).
• Police criminalist Dennis Fung testified that this DNA evidence
put Simpson at Nicole Brown's townhouse at the time of the
murders. But in cross-examination by Barry Scheck, which
lasted eight full days, most of the DNA evidence was
questioned. Dr. Robin Cotton, of Cellmark Diagnostics,
testified for six days. Blood evidence had been tested at two
separate laboratories, each conducting different tests.
http://en.wikipedia.org/wiki/O._J._Simpson_murder_case#DNA_evidence
From Wikipedia on the OJ Case…
• Despite that safeguard, it emerged during the cross-examination of Fung
and the other laboratory scientists that the police scientist Andrea Mazzola
(who collected blood samples from Simpson to compare with evidence
from the crime scene) was a trainee who carried the vial of Simpson's blood
around in her lab coat pocket for nearly a day before handing it over as an
exhibit. While two errors had been found in the history of DNA testing at
Cellmark, one of the testing laboratories, in 1988 and 1989, the errors were
found during quality control tests and had not occurred since. In the 1988
test, one of the companies hired for DNA consulting by Simpson's defense
also made the same error. What should have been the prosecution's strong
point became their weak link amid accusations that bungling police
technicians handled the blood samples with such a degree of incompetence
as to render the delivery of accurate and reliable DNA results almost
impossible. The prosecution argued that they had made the DNA evidence
available to the defense for its own testing, and if the defense attorneys
disagreed with the prosecution's tests, they could have conducted their
own testing on the same samples. The defense had chosen not to accept
the prosecution's offer.
http://en.wikipedia.org/wiki/O._J._Simpson_murder_case#DNA_evidence
From Wikipedia on the OJ Case…
• On May 16, Gary Sims, a California Department of
Justice criminalist who helped establish the
Department of Justice's DNA laboratory, testified
that a glove found at Simpson's house tested
positive for a match of Goldman's blood.
http://en.wikipedia.org/wiki/O._J._Simpson_murder_case#DNA_evidence
Gel Electrophoresis: Uses
• Similarly, blood found on
various locations can be
electrophoresed to determine
the source of the sample.
– In this example, it appears as
though the victim’s blood is
found on all three clothes
samples by matching the
bands.
• That’s what we call those stripes.
Gel Electrophoresis: Uses
• So the point is that you can
identify unknown DNA since
it will have the same size
fragments.
• Some other details:
– DNA is usually dyed to it
appears in the gel, sometimes
under a black light.
• Ethidium bromide binds to DNA
and fluoresces.
Gel Electrophoresis: Uses
• Besides forensics, you can also determine
approximate evolutionary relationships using
relative fragment sizes:
1
2
3
4
5
Turtle Snake Rat Squirrel
1
2
3
4
Fruit Fly
5
Gel Electrophoresis: Uses
• You can also can test for genetic
diseases by comparing normal
allele samples with disease alleles:
– For example, this is used to detect
Huntington’s disease.
• Caused by a dominant allele, too.
Gel Electrophoresis: Uses
• And you can test paternity this way too.
• Key: Every band in the child must match one
in either of its parents.
Mom
F1
http://rarerborealis.com/wordpressblog/tag/maury/
F2
Child
Paternity Testing Animation
• Paternity Testing
Restriction Mapping
• Using gel electrophoresis with bacterial DNA,
we can also create a restriction map.
• This is good for keeping track of plasmids with
inserts (genes inserted into the circle of DNA),
and for identifying exactly how many
fragments we’ll get of varying lengths after a
digest.
– Here’s what I mean…
The pGLO Plasmid
Arabinose Operon
Red lines indicate
restriction sites –
areas where
various restriction
enzymes will
cleave the DNA.
Origin of Replication
[that’s where it starts
copying]
GFP Gene
Ampicillin Resistance
Gene
Restriction Mapping
• Suppose I show you the following plasmid:
p401D
20 kb
• So it’s 20 kb (kilobases) long. Let’s add the
restriction sites for enzyme EcoRI.
Restriction Mapping
• There.
EcoRI
5 kb
p401D
20 kb
15 kb
EcoRI
• EcoRI cuts this plasmid in two places, creating
two DNA fragments (one 5 kb, the other 20 kb).
Restriction Mapping
• That’s a basic restriction map, but sometimes
they get more complicated.
EcoRI
5 kb
p401D
20 kb
15 kb
EcoRI
• Let’s try the Restriction Mapping worksheet.
• Note: #5 is challenging. I’ll solve #6 next slide.
Restriction Mapping Worksheet #6
1.80 kb
Solve each digest
independently.
0.70 kb
HhaIII
HhaIII
pDA102
4.35 kb
SalI
SalI
0.25 kb
SalI
2.30 kb
SalI Digest
pDA102
4.35 kb
1.55 kb
2.10 kb
HhaIII
HhaIII Digest
Restriction Mapping Worksheet #6
Combine them.
0.70 kb
1.80 kb
HhaIII
HhaIII
pDA102
4.35 kb
SalI
SalI
0.25 kb
SalI
2.30 kb
SalI Digest
pDA102
4.35 kb
1.55 kb
2.10 kb
HhaIII
HhaIII Digest
Restriction Mapping Worksheet #6
SalI
1.80 kb
HhaIII
0.70 kb HhaIII
HhaIII
HhaIII
1.55 kb
Using the single
digest lengths,
fill in the known
fragment
lengths, making
sure they “make
sense.”
pDA102
4.35 kb
SalI
SalI
SalI
0.25 kb
SalI
HhaIII
SalI
2.30 kb
HhaIII
2.10 kb
Restriction Mapping Worksheet #6
0.70 kb
HhaIII
0.75 kb
HhaIII
pDA102
4.35 kb
0.35 kb
A general hint is
to find numbers
in the double
digest that add
up to numbers
in the single
digest.
SalI
0.25 kb
SalI
1.20 kb
SalI
1.10 kb
HhaIII
Closure: The Future?
• Anyone hear of CRISPR (say: “crisper”) before?
• CRISPR stands for clustered regularly
interspersed short palindromic repeats and is
a way that bacteria defend themselves against
viral infection.
– It’s not a restriction enzyme-based defense.
• CRISPR refers to a bunch of repeating sections
of DNA in their genome with strange unique
sections between the repeats.
http://gizmodo.com/everything-you-need-to-know-about-crispr-the-new-tool-1702114381
Closure: The Future?
• Those unique sections match the genomes of
viruses that infect bacteria.
– Whoa.
• Associated with the CRISPR DNA is a section of
genes that codes for CRISPER-associated proteins
(Cas), and those proteins act like restriction
enzymes, slicing up invading viruses.
– In truth they’re not true restriction enzymes. The
unique viral DNA is transcribed to RNA which
combines with Cas proteins to seek out real viral DNA.
http://gizmodo.com/everything-you-need-to-know-about-crispr-the-new-tool-1702114381
Closure: The Future?
• So how does that fit with DNA technology?
– We can edit genes with it!
• As Gizmodo puts it, “Cas9 is an enzyme that
snips DNA, and CRISPR is a collection of DNA
sequences that tells Cas9 exactly where to
snip.”
• Give Cas9 a sequence of guide RNA and it will
use it as a reference to snip existing DNA in
whichever way you want.
http://gizmodo.com/everything-you-need-to-know-about-crispr-the-new-tool-1702114381
Closure
• Genome Editing with CRISPR-Cas9
• NOVA – Cracking Your Genetic Code