Transcript Biotechnology - Valhalla High School

Biotechnology
What is biotechnology?
• Biotechnology is formally defined as the
science of using living things, and
components of living things, to produce
goods and services.
• It involves manipulating and modifying
organisms, often at the molecular level, to
create new and practical applications for
agriculture, medicine and industry.
It isn’t new
• It is not new…Bread,
fermented beverages and
cheese are all products of
biotechnology that have
been around for
thousands of years.
• Even selecting the best
crops to plant can be
considered an application
of biotechnology.
Yeast and bacteria
• Bread, alcohol, yogurt
and cheese all involve
the action of microorganism in their
creation.
• Bread and alcohol use
yeast, while yogurt use
bacteria.
• Cheese is made using
an enzyme called
Rennin. Some cheese
also contains molds.
Modern biotechnology
• Modern
biotechnology
generally refers to
alterations carried
out on the cell or
molecular level.
• This new field of
science began in the
late 1970’s.
Bacteria gene splicing
• With an increased knowledge of genetics,
scientists have been able to isolate individual
genes on chromosomes.
• Using substances called restriction enzymes,
geneticists have been able to cut out desired
genes.
• They are then able to insert these desirable
genes into a different organism.
What are restriction enzymes?
• These enzymes were discovered in bacteria.
• Each restriction enzyme recognizes a certain DNA
sequence, and cuts it.
• For example: A restriction enzyme may recognize the
sequence, “TTGG”.
• Everytime this “enzyme” sees this sequence, it cuts the
strand between the T and the G
• This action turns a long strand of DNA into several
smaller strands.
Example
• CGTTGGATTACATTGGCCGATATTGGAC
• If this strand is treated with our restriction
enzyme that recognizes TTGG we would
wind up with this.
• CGTT GGATTACATT GGCCGATATT
GGAC
• Instead of one long strand, we know have 4
shorter strands.
Applications
• Geneticists can now use restriction enzymes to cut
out useful genes and then insert them into another
organisms DNA.
• The human gene for insulin can be cut out of the
healthy cell and “spliced” the DNA of a bacteria.
• This new bacterial DNA is called “recombinant
DNA”.
• Bacteria with recombinant DNA will now be able to
produce Human insulin.
• This processes has saved the lives of literally
millions of people suffering from diabetes.
Other applications
• Gene splicing has recreated recombinant
DNA in many species.
• Some plants have been genetically altered to
be pest and frost resistant.
• Scientists have also used gene splicing to
create new animal genotypes and
phenotypes.
• http://www.youtube.com/watch?v=n0UzdYRn
MtY
Cloning
• Cloning is the creation of an organism that is
genetically identical to another organism.
• Cloning in plants has been going on for
thousands of years.
• Many plants make clones of themselves
without any human intervention.
• In other cases, plants with desirable
characteristics were cloned by taking a
cutting from that plant and growing a new
plant.
Animal cloning
• First attempted in 1950’s frogs, fish and mice
were created.
• In these cases the DNA of non-differentiated
embryonic cells was removed and placed into
an egg cell.
• The failure rate was very high. Very few
clones were created.
• Dolly the sheep was something different.
Somatic Cell Nuclear Transfer
• Or SCNT is the process by which the
entire nucleus of an adult somatic cell is
removed and placed into an egg cell
that has its nucleus removed.
• This is the process used to create Dolly.
• http://www.youtube.com/watch?v=3TFF
6Gbx8tk
Ethics and cloning.
• Since Dolly the sheep was cloned in
1998, many other mammals have been
cloned in this manner.
• Cat and Dog owners have paid tens of
thousands of dollars to create clones of
their beloved pets.
• The technology exists so what about
cloning humans?
Human cloning
• There are two main branches to
consider.
• Theraputic cloning would involve the
cloning of human cells for medical
purposes.
• This type of cloning could lead to the
treatment of such diseases as cancer
and diabetes.
Reproductive cloning
• In this type of cloning an entire human being
would be cloned creating a new individual.
• http://www.youtube.com/watch?v=7tbxN5uwa
qA
• Can you think of arguments for human
reproductive cloning?
• Can you think of arguments against human
reproductive cloning?