Transcript ppt

A. Gene Mutation
1. Mutations are Classified in Different Ways:
2. The Rates of Spontaneous Mutations:
3. How Spontaneous Mutations Occur:
4. Mutagens and Their Effects:
a. Base Analogs:
these are other chemicals that mimic one base and are inserted
in DNA replication, but have higher rates of tautomerism and change to bind a
new base.
Tautomeric
shift
A. Gene Mutation
1. Mutations are Classified in Different Ways:
2. The Rates of Spontaneous Mutations:
3. How Spontaneous Mutations Occur:
4. Mutagens and Their Effects:
a. Base Analogs:
b. Alkylating Agents and Acridine Dyes:
Acridine dyes insert themselves in the template and change the
distance between bases, typically resulting in a base being missed during
replication (nitrous acid (HNO2), hydroxylamine, hydrazine, H2O2).
A. Gene Mutation
1. Mutations are Classified in Different Ways:
2. The Rates of Spontaneous Mutations:
3. How Spontaneous Mutations Occur:
4. Mutagens and Their Effects:
a. Base Analogs:
b. Alkylating Agents and Acridine Dyes:
c. Radiation:
- UV
Causes neighboring
T’s to bind (thymidine
dimer), screwing up
replication
A. Gene Mutation
1. Mutations are Classified in Different Ways:
2. The Rates of Spontaneous Mutations:
3. How Spontaneous Mutations Occur:
4. Mutagens and Their Effects:
a. Base Analogs:
b. Alkylating Agents and Acridine Dyes:
c. Radiation:
- UV
- high energy (cosmic, gamma, X)
A. Gene Mutation
1. Mutations are Classified in Different Ways:
2. The Rates of Spontaneous Mutations:
3. How Spontaneous Mutations Occur:
4. Mutagens and Their Effects:
5. Detecting Mutagens: The Ames test:
Use a strain of Salmonella bacteria
that cannot synthesize the amino
acid histidine.
Use a strain of Salmonella bacteria
that cannot synthesize the amino
acid histidine.
Plate it on a his- medium and look
for colonies that CAN synthesize
their own histidine and must have
mutated.
Use a strain of Salmonella bacteria
that cannot synthesize the amino
acid histidine.
Add liver enzymes
because many
compounds are not
mutagenic until the
are digested or
‘detoxified’ by liver
Plate it on a his- medium and look
for colonies that CAN synthesize
their own histidine and must have
mutated.
Use a strain of Salmonella bacteria
that cannot synthesize the amino
acid histidine.
Add liver enzymes
because many
compounds are not
mutagenic until the
are digested or
‘detoxified’ by liver
Plate it on a his- medium and look
for colonies that CAN synthesize
their own histidine and must have
mutated. Compare spontaneous
rates to rates in presence of
compound
A. Gene Mutation
B. DNA Repair
- All organisms have repair mechanisms that can proof-read and correct errors in
replication, and can repair damaged DNA in cells.
A. Gene Mutation
B. DNA Repair
1. Proofreading:
DNA polymerases have exonuclease activity; so when they add an incorrect
base, they can cleave it out and replace it with a new one…this reduces
error rate 100-fold.
A. Gene Mutation
B. DNA Repair
1. Proofreading:
2. Mismatch repair: mismatched can be detected by enzymes; but how do they
recognize which base is wrong?
A. Gene Mutation
B. DNA Repair
1. Proofreading:
2. Mismatch repair: mismatched can be detected by enzymes; but how do they
recognize which base is wrong?
- prior to synthesis, a methylase enzyme recognizes the sequence GATC and
methylates the adenine on both template strands.
CTAG
A. Gene Mutation
B. DNA Repair
1. Proofreading:
2. Mismatch repair: mismatched can be detected by enzymes; but how do they
recognize which base is wrong?
- prior to synthesis, a methylase enzyme recognizes the sequence GATC and
methylates the adenine on both template strands.
CTAG
- after replication, if the mismatch is recognized by the repair enzyme, it
cuts the unmethylated strand and cleaves bases through the mismatch site.
Polymerase fills the gap and ligase links the last phosphodiester bond.
CGCTACGGATCCGTGTACATGGATCCTAG
GCGATGCCTAGGCATATGTACCTAGGATC
Mismatched pair… which is the correct base, G or T?
A. Gene Mutation
B. DNA Repair
1. Proofreading:
2. Mismatch repair: mismatched can be detected by enzymes; but how do they
recognize which base is wrong?
3. Recombinational Repair:
Sometimes the polymerase will just skip over a thymidine dimer, creating a
‘lesion’ (gap). Recombination enzymes will repair the gap with the AA
sequence from the other chromatid, which provides the A’s necessary to
bind the thymines correctly. The gap in the chromatid can easily be filled
because the template is correct.
A. Gene Mutation
B. DNA Repair
1. Proofreading:
2. Mismatch repair: mismatched can be detected by enzymes; but how do they
recognize which base is wrong?
3. Recombinational Repair:
There is a similar pattern, of using the homolog, in double-break repair
Nucleotide Excision Repair
30 genes regulate the
recognition, excision, and
repair of thymidine dimers.
Xeroderma pigmentosum:
Mutations in these genes
involved in repair mean that
mutations persist.
Cancer
Cancer
A. What is Cancer?
- Cancer is characterized by proliferation (growth and division of cells) and
metastasis (infection of new tissues).
Cancer
A. What is Cancer?
- Cancer is characterized by proliferation (growth and division of cells) and
metastasis (infection of new tissues).
PROLIFERATION forms a tumor.
If this tumor is localized and the cells are immobile, it is benign.
If cells in the tumor gain the ability to migrate to other tissues, then the
tumor is malignant and can metastasize.
Cancer
A. What is Cancer?
- Cancer is characterized by proliferation (growth and division of cells) and
metastasis (infection of new tissues).
- It (they – because they are a body of different diseases) is a GENETIC
disease, caused by genetic changes in the cell that leads to the
characteristics, above.
Cancer
A. What is Cancer?
- Cancer is characterized by proliferation (growth and division of cells) and
metastasis (infection of new tissues).
- It (they – because they are a body of different diseases) is a GENETIC
disease, caused by genetic changes in the cell that leads to the
characteristics, above.
- However, cancer is usually not heritable: it affects somatic tissue. Rather,
the genetic susceptibility to mutagens may be heritable.
Cancer
A. What is Cancer?
- Cancer is characterized by proliferation (growth and division of cells) and
metastasis (infection of new tissues).
- It (they – because they are a body of different diseases) is a GENETIC
disease, caused by genetic changes in the cell that leads to the
characteristics, above.
- However, cancer is usually not heritable: it affects somatic tissue. Rather,
the genetic susceptibility to mutagens may be heritable.
- Finally, it is not a single-gene disease; it is usually caused by several
mutations that affect cell division and DNA repair. Of course, when these
things are affected, mutations accumulate and the problems get worse in the
cell…leading to large scale chromosomal aberrations
Cancer
A. What is Cancer?
- All cells in a tumor are descended from one initial cancer cell that finally
accumulated enough mutations in CDC genes to proliferate.
Evidence: Within a tumor in a female, all cells have the same X
inactivated…suggesting they are descended from a single cell.
Cancer
A. What is Cancer?
B. Cancer can occur because of mutations in DNA Repair Genes
1. XP – xerodermal pigmentosum – a
rare hereditary cancer
People with XP have
mutations in one of the seven
proteins needed for thymidine
dimer repair… so UV light causes
accumulated damage that
eventually affects CDC genes and
causes proliferation and
malignancy.
Cancer
A. What is Cancer?
B. Cancer can occur because of mutations in DNA Repair Genes
C. Ultimately, however, proliferation is caused by mutations in CDC genes
Cancer
A. What is Cancer?
B. Cancer can occur because of mutations in DNA Repair Genes
C. Ultimately, however, proliferation is caused by mutations in CDC genes
1. Most mature cells enter a quiescent and specialized G0 stage, in which
they no longer divide unless stimulated by external growth signals
(hormones or growth factors).
Cancer
A. What is Cancer?
B. Cancer can occur because of mutations in DNA Repair Genes
C. Ultimately, however, proliferation is caused by mutations in CDC genes
1. Most mature cells enter a quiescent and specialized G0 stage, in which
they no longer divide unless stimulated by external growth signals
(hormones or growth factors).
2. The binding of these signals to
the outside of the cell membrane activates
“signal transduction” molecules on the
inside of the membrane; these set off a
cascade of events that ultimately stimulate
division and return the cell from the G0 to
the G1 and the divisional cell cycle.
Cancer
A. What is Cancer?
B. Cancer can occur because of mutations in DNA Repair Genes
C. Ultimately, however, proliferation is caused by mutations in CDC genes
1. Most mature cells enter a quiescent and specialized G0 stage, in which
they no longer divide unless stimulated by external growth signals
(hormones or growth factors).
2. The binding of these signals to
the outside of the cell membrane activates
“signal transduction” molecules on the
inside of the membrane; these set off a
cascade of events that ultimately stimulate
division and return the cell from the G0 to
the G1 and the divisional cell cycle.
3. Signal transduction is also
involved in signaling the cell to stop
growing and enter G0.
Cancer
A. What is Cancer?
B. Cancer can occur because of mutations in DNA Repair Genes
C. Ultimately, however, proliferation is caused by mutations in CDC genes
1. Most mature cells enter a quiescent and specialized G0 stage, in which
they no longer divide unless stimulated by external growth signals
(hormones or growth factors).
2. The binding of these signals to the outside of the cell membrane
activates “signal transduction” molecules on the inside of the membrane;
these set off a cascade of events that ultimately stimulate division and
return the cell from the G0 to the G1 and the divisional cell cycle. One
major family of signal transduction genes are ras genes.
3. Sometimes, cancer is caused by:
- mutations in signal transduction genes that stay on – even if
cue is not present; or stay on, even if inhibitor is present.
Cancer
A. What is Cancer?
B. Cancer can occur because of mutations in DNA Repair Genes
C. Ultimately, however, proliferation is caused by mutations in CDC genes
D. Regulation of the Cell Division Cycle
1. In order for the G1/S transition, about 20-30 genes
must be turned on (to make all the replication
enzymes, origin replicating factors, etc.)
G1/S
checkpoint
1. In order for the G1/S transition, about 20-30
genes must be turned on (to make all the
replication enzymes, origin replicating factors,
etc.)
2. These genes are “up-regulated” by the binding of
E2F transcription factors to their promoters….
E2F
G1/S
checkpoint
RB
E2F
G1/S
checkpoint
1. In order for the G1/S transition, about 20-30
genes must be turned on (to make all the
replication enzymes, origin replicating factors,
etc.)
2. These genes are “up-regulated” by the binding of
E2F transcription factors….
3. But during G1, E2F’s are bound by the
retinoblastoma protein (RB) and CAN’T bind to
DNA and activate the replication genes… So the
RB protein is a cell-progression inhibitor.
RB
E2F
G1/S
checkpoint
3. But during G1, E2F’s are bound by the
retinoblastoma protein (RB) and CAN’T bind to
DNA and activate the replication genes… So the
RB protein is a cell-progression inhibitor.
4. Now, RB can be inactivated by phosphorylation –
which is what kinases do. These kinases are
present all the time, but they are activated by
cyclins whose concentrations vary through the
cell cycle… so these are cyclin-dependent kinases
or CDK’s.
D2
CDK4
PO4
RB
E2F
G1/S
checkpoint
4. Now, RB can be inactivated by
phosphorylation – which is what
kinases do. These kinases are
present all the time, but they are
activated by cyclins whose
concentrations vary through the
cell cycle… so these are cyclindependent kinases or CDK’s.
5. SO! [Cyclin D2] increase through
G1…. They bind/activate CDK4 and
CDK6…
CDK4
D2
PO4
RB
E2F
G1/S
checkpoint
4. Now, RB can be inactivated by
phosphorylation – which is what
kinases do. These kinases are
present all the time, but they are
activated by cyclins whose
concentrations vary through the
cell cycle… so these are cyclindependent kinases or CDK’s.
5. SO! Cyclin D2 increase through
G1…. They bind/activate CDK4 and
CDK6… which phosphorylate RB,
inactivating it such that it releases
E2F. … which is now free to
stimulate transcription of
replication genes needed for the S
phase.
So cyclin D2 stimulate cell cycle and
cell division and proliferation.
What influences the concentration
of cyclin D?
Myc is a transcription factor that
stimulates cyclinD production and
down-regulates p21 activity … so it
stimulates cell proliferation.
(It binds to enhancer regions and may
stimulate up to 15% of all genes. Its
binding moves histones off genes,
allowing them to be turned on
further. It is important in stimulating
protein synthesis and cell growth, as
well as cell proliferation.
First found in Burkitt’s lymphoma,
where enhancers are translocated to
chromosome 8 and lock it in the ‘on’
position. Sequence similar to an
avian virus that causes
myelocytomatosis…”myc”)
Myc is a transcription factor that
stimulates cyclinD production … so it
stimulates cell proliferation.
P53 is a transcription factor that
increases in concentration when there
is DNA damage. It stimulates
production of the p21 protein, which
blocks CDK4 activity, and the RB
protein remains bound to E2F’s and
cell progression is stalled. So, p53 is a
cell-cycle inhibitor. 50% of all cancers
involve mutations in the p53 gene,
removing this inhibiting effect!
The other critical checkpoint is the G2/M
transition, which is regulated by the binding of
cyclin-B to CDK1. It reorganizes the
cytoskeleton to form the spindle, and
stimulates the formation of Anaphase
Promoting Complexes. Eventually, the APC’s
are activated, and they digest the protein in
the kinetochore holding the sister chromatids
together, and they also digest cyclin-B in a
negative feedback loop.
APC’s
Degradation
of Cyclin B
Separation of
chromatids
Cancer
A. What is Cancer?
B. Cancer can occur because of mutations in DNA Repair Genes
C. Ultimately, however, proliferation is caused by mutations in CDC genes
D. Regulation of the Cell Division Cycle
E. Oncogenes, Tumor Supressors, and Viruses
E. Oncogenes, Tumor Supressors, and Cancer
1. Oncogenes:
In a rather backwards way, “oncogenes” are mutated genes that
cause cancer by over-stimulating cell division. Their unmutated normal
form are called “proto-oncogenes” that stimulate division correctly.
E. Oncogenes, Tumor Supressors, and Cancer
1. Oncogenes:
In a rather backwards way, “oncogenes” are mutated genes that
cause cancer by over-stimulating cell division. Their unmutated normal
form is called a “proto-oncogenes” and they stimulate division correctly.
The classic example is the ras oncogene family, that function in signal
transduction pathways. (“ras” because it was first isolated in rat sarcoma
cancers.)
1. A growth factor binds to a receptor on the
membrane, causing its activation
(phosphorylation)
1. A growth factor binds to a receptor on the
membrane, causing its activation
(phosphorylation)
2. Through protein intermediates, this causes the
ras protein to release GDP and bind GTP,
activating it.
1. A growth factor binds to a receptor on the
membrane, causing its activation
(phosphorylation)
2. Through protein intermediates, this causes the
ras protein to release GDP and bind GTP,
activating it.
3. Ras initiates a phosphorylation cascade,
ultimately stimulating kinases that…
1. A growth factor binds to a receptor on the
membrane, causing its activation
(phosphorylation)
2. Through protein intermediates, this causes the
ras protein to release GDP and bind GTP,
activating it.
3. Ras initiates a phosphorylation cascade,
ultimately stimulating kinases that…
4. Initiate a signal transduction pathway across
the nuclear membrane, stimulating
transcription factors that regulate cell
proliferation genes.
1. A growth factor binds to a receptor on the
membrane, causing its activation
(phosphorylation)
2. Through protein intermediates, this causes the
ras protein to release GDP and bind GTP,
activating it.
3. Ras initiates a phosphorylation cascade,
ultimately stimulating kinases that…
4. Initiate a signal transduction pathway across
the nuclear membrane, stimulating
transcription factors that activate cell
proliferation genes.
5. Critically, after initiating the cascade, ras
hydrolyzes GTP to GDP and becomes inactive
again.
1. A growth factor binds to a receptor on the
membrane, causing its activation
(phosphorylation)
2. Through protein intermediates, this causes the
ras protein to release GDP and bind GTP,
activating it.
3. Ras initiates a phosphorylation cascade,
ultimately stimulating kinases that…
4. Initiate a signal transduction pathway across
the nuclear membrane, stimulating
transcription factors that activate cell
proliferation genes.
5. Critically, after initiating the cascade, ras
hydrolyzes GTP to GDP and becomes inactive
again.
6. 6. But WHEN mutated to an oncogene, it does
NOT hydrolyze GTP – and remains active –
continuing to stimulate the cell proliferation
cascade. Ras mutations occur in 40% of
cancers.
E. Oncogenes, Tumor Supressors, and Viruses
1. Oncogenes:
2. Tumor Suppressors:
These are genes that normally inhibit cell division. When mutated,
that inhibition is released and the cell divides. The p53 gene is an
example, as is RB and BRCA2 that is associated with breast cancer.
E. Oncogenes, Tumor Supressors, and Viruses
1. Oncogenes:
2. Tumor Suppressors:
These are genes that normally inhibit cell division. When mutated,
that inhibition is released and the cell divides. The p53 gene is an
example.
P53 also can initiate apoptosis – programmed cell death – if there is too
much DNA damage.
E. Oncogenes, Tumor Supressors, and Viruses
1. Oncogenes:
2. Tumor Suppressors:
These are genes that normally inhibit cell division. When mutated,
that inhibition is released and the cell divides. The p53 gene is an
example.
P53 also can initiate apoptosis – programmed cell death – if there is too
much DNA damage.
So, mutations in this gene short-circuit cell regulation and cell suicide;
resulting in the survival and replication of cells with very damaged DNA cancer!!
E. Oncogenes, Tumor Supressors, and Viruses
1. Oncogenes:
2. Tumor Suppressors:
3. Viruses:
Viruses cause 15% of all human cancers.
Viruses cause cancer 2 ways:
1) viruses insert their DNA into the hosts genome. The sites of
insertion may “up-regulate” proto-oncogenes or destroy tumor
suppressor genes.
E. Oncogenes, Tumor Supressors, and Viruses
1. Oncogenes:
2. Tumor Suppressors:
3. Viruses:
Viruses cause 15% of all human cancers.
Viruses cause cancer 2 ways:
1) viruses insert their DNA into the hosts genome. The sites of
insertion may “up-regulate” proto-oncogenes or destroy tumor supressor
genes.
2) Also, when the viral DNA is replicated, it may copy a neighboring
proto-oncogene, as well. This now becomes part of the viral genome – a
“viral oncogene”.
E. Oncogenes, Tumor Supressors, and Viruses
1. Oncogenes:
2. Tumor Suppressors:
3. Viruses:
Viruses cause 15% of all human cancers.
Viruses cause cancer 2 ways:
1) retroviruses insert their DNA into the hosts genome. The sites of
insertion may “up-regulate” proto-oncogenes or destroy tumor supressor
genes.
2) Also, when the viral DNA is replicated, it may copy a neighboring
proto-oncogene, as well. This now becomes part of the viral genome – a
“viral oncogene”.
- when it’s inserted in a new host, it is overexpressed
- or, it gets mutated and is even MORE overexpressed…
E. Oncogenes, Tumor Supressors, and Viruses
1. Oncogenes:
2. Tumor Suppressors:
3. Viruses:
4. Environmental Mutagens:
- Anything that damages DNA can cause cancer, if it ends up damaging cdc
genes. Tobacco has chemicals that preferentially mutate ras and p53.