Transcript Sample Poster 4 - Cardiff University

Construction of a reporter gene expressing E coli K12 as
a tool for phage growth kinetics and life imaging
Danielle Donoghue and Joachim J. Bugert ‡
‡ CI3/ Medical Microbiology and Infectious Diseases, School of Medicine, Cardiff University, Heath Park, Cardiff, CF14 4XN
Abstract
Fig. 3: Transfer of ampicillin and kanamycin resistance casettes into the recA locus
The aim of this project was to construct an E coli strain K12 expressing reporter genes, eg
firefly luciferase (FF), or enhanced green fluorescent protein (EGFP) from a chromosomal locus
using the recombineering method (1). Luciferase/EGFP expressing E coli have been described
in the literature, but all from plasmid, which can only be maintained by antibiotic selection and
are therefore transient constructs. We have identified the recA and the lacZ loci as suitable
target regions in the E coli chromosome. The K12 strain of E coli is an attenuated plasmid-free
strain and a standard organism used in GM experiments. K12-SW102 contains the BAD gene
complex protecting openended dsDNA transfer casettes produced by PCR. First, an ampicillin
(amp) resistance casette was engineered to replace the recA gene in E coli K12-SW102. A FF
transfer casette with kanmycin (kan) as selection marker was then used to isolate kan resistant
colonies. However, FF luciferase activity was not detectable. FF and EGFP expression casettes
using the indigenous lacZ promoter were then engineered to replace the lacZ protein unit in E
coli K12- SW102 and identified by b/w selection. EGFP positive colonies were isolated. A FF
reporter is under construction. The reporter strains will be used for phage kinetics and imaging
of phage kill in a small animal model.
A
B
Fig. 4: Transfer of the EGFP expression casette with amp promoter into K12- SW102
Purity plate
eTrafo FF
b/w selection
P
C
t
eTrafo EGFP
K12-SW102-egfp
5 um
5 um
5 um
5 um
Fig. 1: Strategy for transfer of reporter expression casettes
Summary
Table 1: Oligonucleotide Primers used
During this 11 week project we were able to: i.. Transfer an ampicillin expression cassette
(1026 bp ) from ILR#217 (Fig. 2) into the rec A locus of E coli strain SW102 (E coli K12
constitutively expressing the BAD gene complex) (1) and induced with heatshock, ii.. transfer
in a tree step procedure amp promoter-FF luciferase from ILR#217 via an amp casette (I.)
into the hcmv promoter locus of ILR#17 (II.), and rePCR for a kanamycin –FF expression
cassette (4.399 bp ) into SW102 (E coli K12), as well as J53 wildtype E coli co-transformed
with pSC101 BAD gba tet (2) and induced with L- arabinose (III.).
Primer
#
1
Name of primer
Sequence
Rec A amp 5’
2
Rec A amp 3’
atGGCTATCGACGAAAACAAACAGAAAGCGTTGGCGGCAGCACTG
GGCCAGATTGAGAAAGcgcggaacccctatttgtttat
TTGTGTATCAAACAAGACGATTAAAAATCTTCGTTAGTTTCTGCTAC
GCCTTCGCTATCAGGTCTGACAGTTACCAATGCTTAATCAGTG
atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgatgcagaggc
cgaggccg
TTATTTTTGACACCAGACCAACTGGTAATGGTAGCGACCGGCGCTC
AGCTTTACCAATGCTTAATCAGTGAGGCACCTATC
tatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctATGGAAG
ACGCCAAAAACATAAAGAAAG
TCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATCCGTAATCA
TGGTTTAACTAGTTACACGGCGATCTTTCCGCCCGGGCGGAAAGAT
CGCCGTG
3
5 ' lac Z kan
4
3' FFda lacZ
5
Lac Z FF luci 5’
6
3’ Lac Z FF luci
pCMV
kB4-6
pIRES-EGFP-5´
BamH I (5364)
Apa LI (253)
MCS
EcoR I (630)
Sal I (640)
Luciferase gene
BamH I (661)
IRES
5308 bp
5695 bp
kozak sequenceClaI (4181)
Apa LI (1499)
Bst XI (1254)
EGFP
AvaI (3872)
Apa LI (1989)
amp
SV40 polyA
Not I (1977)
Xba I (1987)
SV40-polyA
sv40-polyA
We were able to construct E coli K12 –SW102-egfp, expressing EGFP. Experiments to isolate
the FF reporter strain are in progress.
pNFkB-Luc AF053315 ILR#217
pIRESegfp-3´
pIRES2-EGFP ILR#17
Cla I (3173)
We interpreted the latter result so that we believe the combined FF luciferase- kanamycin
cassette plus regulatory signals and flanks as well as the three step construction method was
too complicated for the recombineering approach chosen, and we would benefit from
transferring a smaller cassette, expressing only the reporter gene under the control of a
prokaryotic promoter.
To this end we designed new primers (Table 1, primers # 3 to 6) targeting the lacZ locus from
-50 to atg for the left flank and atg to +50 for the right flank, using the locus’ own promoter
(-20) and thereby making the cassettes to be transferred much smaller (FF: 1650 +100 bp;
EGFP:720 +100b).
5' IRES cloning primer
kan-neo
The second experiment was set up to insert both elements FF luciferase and kanamycin
resistance , each with the amp promoter, into the recA locus, of two different E coli strains.
However, in both cases only the selective marker was transferred (Fig. 3B bottom half; Fig. 3C
viability control). In J53 an amp resistance casette used in intermediate construction was
maintained (Fig. 3A, right bottom quarter). The kanamycin resistant strains did NOT express
FF luciferase using PROMEGA Glo FF luciferase kit.
Consequently, we decided to utilise the lac Z locus of E coli K12 (and wildtype strains), to
select for recombinant strains by blue-white selection, instead of using an antibiotic
marker. We decided to use both FF and and EGFP as reporter genes, where recombinant E
coli expressing EGFP can be visualized using UV excitation. The new transfer casettes were
designed to use the in situ lac Z promoter.
Fig 2.: Origins of Transgenes
pCMVie-2
The first experiment confirmed, that we were indeed able to insert a functional ampicillin
resistance gene into the recA gene locus using the primers # 1 and 2 shown in Table 1,
without rendering the recombinant strain unviable (Fig. 3A top left quarter).
EcoR I (3403)
BamH I (2668)
pUC ori
EcoR I (2781)
References
1. Warming, S. Costantino, N. Court, D. Jenkins, N. Copeland, N. 2005. Simple and highly
efficient BAC recombineering using galK selection. Nucleic Acids Research 33(4), pp.1-12
2. Wang, J. Sarov, M. Rientjes, J. Fu, J. Hollak, H. Kranz, H. Xie, W. Stewart, A. Zhang, Y. 2006.
An Improved Recombineering Approach by Adding RecA to λ Red Recombination. Molecular
Biotechnology 32, pp.43-53