Transcript In situ - University of Evansville Faculty Web sites

Chapter 9
Genomics
Mapping and characterizing
whole genomes
16 and 20 February, 2004
Overview
• Genomics is the molecular mapping and characterization
of whole genomes and whole sets of gene products.
• Consecutive high-resolution genetic and physical maps
culminate in the complete DNA sequence.
• Sequencing strategies depend upon the size of the genome
and the distribution of its repetitive sequences.
• Assembly of sequences is done clone by clone or by whole
genome assembly, or both.
• Computational analysis is used to describe encoded
information whereas functional genomics explores
function and interaction of gene products.
Genomics
• Focuses on the entire genome
• Made possible by advances in technology
– automated cloning and sequencing (robotics)
allowing high throughput
– computerized tracking and analysis of
sequences
• Insights into global organization,
expression, regulation and evolution
– enumeration of genes
– identification regulatory and functional motifs
• Functional genomics to determine actual
function of genetic material
Genome projects
• Starts with high-resolution recombination and
cytogenetic maps of each chromosome
• Followed by physical characterization and
positioning of cloned DNA fragments to
anchor to high-resolution map
• Followed by large-scale sequencing and
analysis
– clone-based sequencing
– whole genome shotgun sequencing
• Last step: functional genomics (the hard part)
High-resolution genetic maps
•Start with low-resolution maps from existing
recombination maps
•Next, layer DNA polymorphisms onto map
–e.g., neutral DNA sequence variation not
associated with phenotypic variation
•phenotypic consequences, if any, irrelevant
–such DNA markers behave as allelic gene pairs
and can be detected by Southern blotting or PCR
–mapped by recombination or cytogenetics
RFLP
•
•
•
•
Restriction fragment length polymorphism
May or may not be neutral
Detected by Southern blotting or PCR
Multiple RFLPs can be mapped by classical
segregation analysis
• Example:
A


a


| = cut site
 = primer
– restriction digestion of PCR products yields one
fragment for allele A and two fragments for a
– note that homozygotes and heterozygote have different
restriction patterns, permitting identification of carrier
Physical maps
• Maps of physically isolated pieces of genome, i.e., cloned
DNA
– previously cloned DNA can be localized to map by Southern
blotting or PCR to measure location and distance
– useful in assembly of sequences
• Vectors with large inserts are most useful
• Overlapping clones are assembled into contigs, ideally,
one per chromosome
– mapping of restriction sites
– sequence-tagged sites (STSs)
Short-sequence repeat markers
• Tandemly repeated
• Variable numbers of repeats, give different size
restriction fragments detected on Southern blots
• Single sequence length polymorphisms (SSLPs)
–
–
–
–
e.g., TGACGTATGACGTATGACGTATGACGTA
mutations give rise to large number of alleles
higher proportion of heterozygotes
two types in genomics
• minisatellite (VNTRs)
• microsatellite
Minisatellites and microsatellites
• Minisatellites
– based on variation of number of tandem repeats
(VNTRs) which segregate as alleles
– in humans, repeat unit is 15-100 nucleotides, for total of
1-5 kb
– if number of repeats is variable, Southern blot will
show numerous bands
– basis of DNA fingerprinting and can be used in
mapping
• Microsatellites
– sequences dispersed throughout the genome
– variable numbers of dinucleotide repeats
– detected by PCR
RAPDs
• Randomly amplified polymorphic DNA
• PCR primers with random sequences often
amplify one or more regions of DNA
– primer complement randomly located in
genome
– single primer can detect regions with inverted
repeats
– polymorphisms segregate as alleles and
therefore can be mapped in crosses
• Often used in evolutionary studies
Human high-resolution map
•RFLP, SSLP, and RAPD markers have been
mapped to 1cM density
•Provide landmarks for anchoring sequence
information
•1 cM of human DNA is ~ 1 Mb of DNA, still
a large amount
•Single nucleotide polymorphisms (SNPs)
estimated number about 3 million between
any two genomes
High-resolution cytogenetic maps
• Relates markers to chromosome bands,
puffs or disruptions
• In situ hybridization
– cloned DNA labeled with radioactivity or
fluorescent dye (FISH)
– hybridized to denatured metaphase or polytene
chromosomes
– indicates approximate locations
– FISH extension allows chromosome painting
• Rearrangement breakpoint mapping
– detected by Southern blotting
Assembling genomes with
repetitive sequences
• Use of ordered clones
– e.g., C. elegans
– large mapped, cosmids with minimum overlap (minimum
tiling path) subcloned into sequencing vectors
– inserts sequenced by automated methods
– sequence assembled by computer based on map
• Whole genome shotgun
– e.g., D. melanogaster
– three libraries (2-kb, 100-kb, 150-kb) of genomic clones,
each sequenced from both ends
– sequences aligned by homologous sequence overlap and
by use of paired-end sequences to produce scaffolds of
contigs
Assembling genomes
• If genome is rich in repetitive elements, contigs
may be short
• Gaps usually occur, regardless of technique
– short gaps filled by PCR
– long gaps require additional cloning, sometimes
in different host
• Sequenced eukaryotic genomes include:
Saccharomyces cerevisiae, Caenorhabditis
elegans, Drosophila. melanogaster, Arabidopsis
thaliania, Mus musculus, Danio rerio, Homo
sapiens
Bioinformatics (1)
• Not clear what all of nucleotide sequence of draft
genome means
• In addition to proteome (protein encoding
sequences), genome contains additional information
• Considerable ignorance due to the following:
– docking (target) sequences of many DNA binding
proteins are unknown
– alternative splicing complicates ORF finding
– some sequences have context-dependent meaning
– some sequences have multiple uses
• Bioinformatics and functional genomics attempt to
decipher genome
Bioinformatics (2)
• Uses available information (much of it available
on the Web) to predict function of sequences
• cDNA evidence
– motifs, e.g., start codons, ORFs
– expressed sequence tags (ESTs), from reverse
transcribed mRNA
• mRNA and ORF structure
– gene and intron finding programs
• Polypeptide similarity evidence
– at level of >35% sequence identity, polypeptides likely
have common function
– often identified by BLASTp search
• Codon bias information
Functional genomics
• Study of expression and interaction of gene
products
• Requires new vocabulary and techniques
– transcriptome: all DNA transcripts
• may be monitored by use of DNA chips
– proteome: all encoded proteins
• complicated by alternative splicing
– interactome: all interactions between all
categories of molecules
• detected by two-hybrid system and related
procedures
– phenome: phenotype of each gene knockout
Assignment:
Continue with * section of the Web
tutorial.