Transcript 14-3 Human Molecular Genetics

How do you
handle huge
amounts of
information?
When looking in an
encyclopedia you use an index
When biologists search the
volumes of the human genome
using sequences of DNA bases.
Testing for alleles
You suspect you might be carrying
recessive alleles for a genetic
disorder like cystic fibrosis or TaySachs disease, how can you find
out???
Both of them are slightly
different DNA sequences
from their normal
counterparts, a variety of
genetic tests have been
develop.
These are specific DNA base
sequences that detect the
complementary base sequences
found in the disease- causing allele
Test also detect
differences between
the lengths of
normal and
abnormal alleles.
Genetic tests are now available for
hundreds of disorders.
DNA testing can pinpoint the
exact genetic basis of a disorder,
making it possible to develop
more effective treatment for
individuals affected by genetic
disease.
DNA Fingerprinting
It does not analyze the cell’s most
important genes, which are largely
identical among most people.
It analyze sections of DNA that have
little or no known function but vary
widely from one individual to
another.
Except, identical twins
The Human Genome Project
 DNA sequencing technologies made it
possible, for the first time, to sequence
entire genomes.
 The Human Genome Project is an
ongoing effort to analyze the human
DNA sequence.
Rapid Sequencing
First scientist determined
the sequence of bases in
widely separated
regions of DNA.
This regions were then
used as markers and
made it possible to
locate and return
specific locations in the
genome.
“shotgun sequencing”
involves cutting DNA
into random
fragments and
determine the
sequence of bases in
each fragment.
Computers found areas of
overlap between the
fragments and put the
fragments together by
linking the overlapping
areas.
The computers then aligned
the fragments relative to the
known markers on each
chromosome.
AAATTTGGGCCCCCGGGAAAT
CCCGGGAAATGGATCGATG
This process
is like putting
a jigsaw
puzzle. But
you match
identical base
sequences.
Searching for Genes
Only one part of a human DNA
molecule is made of genes.
I contains aprox 25,000 genes.
Fruit fly has aprox. 14,000 genes
Worm has aprox. 20,000 genes.
One method to find genes is by
finding DNA sequences that are
known to be promoters that are
binding sites for RNA polymerase.
Promoters indicate the start of a
gene.
Then it starts the reading of the gene.
For most genes the mRNA coding
regions or exons have also introns
regions.
Looking for
genes that
may provide
useful clues to
some of the
basic
properties of
life.
All the data base on
human genome is
available to
everybody.
Gene Therapy
 Is the process of changing the gene that
causes a genetic disorder.
In gene therapy, an absent or faulty gene
is replaced by a normal, working gene.
- This way the body can make the correct
protein or enzyme it needs, which
eliminates the cause of the disorder.
One authorized attempt to cure
In 1990 a young girl was
apparently cured on an
inherited immune disorder
when bone marrow were
removed, modified and then
placed back in the body.
Scientists do not
know how long the
beneficial effect of
this treatment will
last.
 There has been attempts for cystic
fibrosis but have not produced a lasting
cure.
 Gene therapy remains a high-risk,
experimental procedure.
Ethical Issues in Human Genetics
 It would be marvelous to be able to
cure hemophilia or other genetic
diseases.
 But if human cells can be manipulated
to cure disease, should biologist try to
engineer taller people or eye color, or
appearance?