Transcript B4 Revision
Variation Inheritance and Natural Selection Revision All species show variation: this can be divided into two groups Blood group Genetic Variation Hair Colour Diseases e.g. Common cold Environmental Variation Variation can either be continuous: E.g. Height Or discontinuous: e.g. Tongue rolling DNA is found in the form of chromosomes which are located in the centre of all cells… the nucleus DNA is made up of 4 base pairs: Adenine always pairs with Thymine Guanine always pairs with Cytosine These chemicals are said to be complimentary DNA replication In order to grow and reproduce, living cells need to duplicate their chromosomes, as happens during cell divisions such as mitosis. This is possible because DNA can replicate itself. The order of the chemicals ACTG in a section of DNA makes a gene E.g. ACCCTGGACCGGTAGTTCGTCCAGTTGCTA A gene is therefore something that codes for a particular characteristic e.g. hair colour If we change this order of chemicals we change the characteristic that is being coded for. ACCCTGGACCGGTAGTTCGTCCAGTTGCTA ACCATGGACCGGTACTTCGTCCAGGTGCTA We call a change like this a mutation Mutations can be bad e.g. Cystic Fibrosis Mutations can be good e.g. Disease Resistance 1. Ultraviolet Light in sunshine or Sun beds. 2. Chemicals in cigarette Smoke. 3. Chemicals in the environment. 4. Background radiation in the environment. 5. Or they can just happen spontaneously. Mutations can happen for many reasons This Mutation can lead to variation : - Variation leads to Evolution Yeah that’s right DARWIN BABY!!! And his wonderful theory NATURAL SELECTION Natural Selection 1) Each species shows variation: Get off my land 2) There is competition within each species for food, living space, water, mates etc 3) The “better adapted” members of these species are more likely to survive – “Survival of the Fittest” Gutted! Yum 4) These survivors will pass on their better genes to their offspring who will also show this beneficial variation. A knowledge of genes allows us to do selective breeding. This is where we decide what characteristics we want in the next generation. The Probability of characteristics being passed on can be decided by a genetic cross diagram Eye colour Example 1: A homozygous brown-eyed parent and a blue-eyed parent: X BB Parents: Gametes: Example 2: 2 heterozygous brown-eyed parents bb Bb X Bb B B b b B b B b Bb Bb Bb Bb BB Bb bB bb (FOIL) Offspring: All offspring have brown eyes 25% chance of blue eyes Phenotype Another method Example 3: A heterozygous brown-eyed father and a blue-eyed mother: Genotype Father B b b Bb bb b Bb bb Mother