Transcript Slide 1
PCR, Theory and Applications Davidson Day Ateh Neuroscience Centre, Institute of Cell and Molecular Sciences Barts and The London School of Medicine and Dentistry Queen Mary University of London Experimental Neuropathology Module - November 2007 Intercalated Experimental Pathology BSc DNA DNA Replication In Vivo DNA replication occurs during cell division • Different types of DNA polymerase (e.g. I, II & III and those involved in DNA repair) • RNA polymerase for transcription • High fidelity DNA synthesis is due to proof reading (only one error per 1 109 nucleotides) DNA Polymerase facilitates replication Polymerase Chain Reaction Or in vitro DNA replication • Gene cloning (recombinant DNA techniques) developed in the 1970’s • PCR originally a slow, labour intensive process that required the addition of fresh DNA Polymerase every replication round Thermus Aquaticus was discovered in the Yellowstone (USA) hotsprings in the 1960’s and thrives at around 72°C • Revolutionised by Kary Mullis in the 1980’s whilst he was working for a biotechnology company • He received the 1993 Nobel Prize in Chemistry for his work • A DNA polymerase (Taq) is used to make many copies of a short length of DNA defined by primers in a test tube • Taq DNA polymerase works optimally at 72°C • Critically it is not denatured at 94°C (thermostable) ONE OF THE MOST IMPORTANT MOLECULAR BIOLOGY TECHNIQUES PCR Mix • Template DNA • Buffer (with Mg2+) • Nucleotides (dNTPs) • Taq DNA Polymerase (or other thermostable DNA polymerase) • Primers PCR Mechanisms Double Stranded DNA Denaturing DNA template Single Stranded DNA Complimentary binding forward and a reverse primers (20-30 oligonucleotides) PCR 100 Melting 94 oC Temperature 30x Melting 94 oC Extension Annealing Primers 50 72 oC 50 oC 0 Time 3’ 5’ 5’ 3’ 3’ 5’ 3’ 5’ 5’ 3’ 5’ 5’ 5’ 3’ 5’ 5’ 3’ 5’ 5’ 5’ 5’ 5’ 3’ 3’ 5’ 3’ PCR 100 Melting 94 oC Temperature 30x Melting 94 oC Extension Annealing Primers 50 72 oC 50 oC 0 Time 3’ 5’ 5’ 3’ 3’ 5’ 3’ 5’ 5’ 3’ 5’ 5’ 5’ 3’ 5’ 5’ 3’ 5’ 5’ 5’ 5’ 5’ 3’ 3’ 5’ 3’ PCR Strands that are too long double in size whereas strands that are just right increase exponentially 5’ Fragments of defined length 5’ 5’ 5’ 5’ 5’ 5’ 5’ DNA Amplification Number 1 2 0 1 Cycles 4 8 16 32 64 2 3 4 5 6 PCR Yield Theoretically, the number of DNA fragment copies obtained can be calculated Yield = 2n y Where y is the initial number of DNA copies and n is the number of thermal cycles If you start with 1000 copies, how many copies are made in 32 cycles? 2n x y = 232 x 1000 = 4,294,967,296 x 1000 = 4,294,967,296,000 Thermal Cyclers Challenges Fidelity of the Reaction • Taq DNA polymerase lacks the proof-reading activity present in other polymerases • Taq makes 1 error per 1 104 nucleotides (remember, 1 per 1 109 nucleotides in vivo) • Thus, a 400 base pair target will contain an error in 33% of molecules after 20 cycles • Error distribution will be random • Does not matter if PCR product is for sequencing or to be cut with restriction enzymes • Does matter if you want to clone the product (use proof-reading thermostable enzyme) Optimising the PCR Reaction • The amount of template and polymerase • Annealing temperature of the primers and their design • The concentration of Mg2+ in the reaction • The extension time and temperature • The denaturing and annealing times The use of PCR • PCR is a DNA ‘amplification’ method, many copies of any DNA template can synthesised • One starting DNA template can be amplified in to an infinite number of copies • “Amplified” fragments of DNA can be sequenced, cloned, probed or sized using electrophoresis • Defective genes can be amplified to diagnose illnesses • Genes from pathogens can be amplified to identify them (e.g. HIV) • Amplified fragments can act as genetic fingerprints using restriction enzymes (nucleases cut, shorten or degrade DNA, Ligases join DNA, polymerases make DNA copies) PCR Practical Example +/+ Genotyping Loa mice Loa/+ T-to-A transversion in the Dnchc1 gene that results in residue 580 changing from phenylalanine (TTC) to tyrosine (TAC) PCR Practical Example Genotyping Loa mice DNA prep from mouse tail Biopsies • Cut 0.8-1.0 cm of mice tail (or equivalent mass of other parts), divide into small pieces and transfer into Eppendorf tube • Add 300l of Lysis buffer and 3l of proteinase K. Incubate tubes at 55C overnight (lysis buffer- 100mM Tris-HCl pH8.0, 5mM EDTA, 0.2% SDS, 200mM NaCl, Proteinase K stock is 20mg/ml New England Biolabs) and leave to digest overnight • Vortex each tube well. Spin 10-15 min to pellet hair etc… • Pour supernatant into empty Eppendorf tube • Dilute 4l in 200l H2O and use 2l of this in 20l PCR reactions for genotyping PCR Practical Example PCR Mix per tube HotStar Taq master mix (Qiagen) MDN-Int7-F (10 uM) MDN2064-R (10 uM) H2O 10ul 2 ul 2 ul 4 ul ----18 ul + 2ul of 1:50 diluted DNA template Genotyping Loa mice Thermocycler 1) 95C 15min 2) 95C 30S 3) 62C 30S 4) 72C 1min 5) Go to 2, 35 times 6) 72C 10min 7) 16C Hold PCR Practical Example Genotyping Loa mice T-to-A change Forward Primer TGCTGCTGAGCTGCGTCCTAGTGCTGTGTGCTCTCCTGTTTTCATTCCCTCTTCACAT TCATTAGTTCTTTCCTTTAAGTATACACACACACACACACACACACACAGTAAAGACA GAAGTCTGCAGGGAGATCCTTATAGTGTGCTCATGGCTGAATTGTGATGATAGAGTCC TAAAGGCCTAGAAGTCAGCATTGATGCAAGAATCCTGTGCTGTGCCTGTGACAGAAAA ACGTCATTTGCAGCTATGTTTTGTTCCAAACCTTTTGTTTTAGGTCACAGCAGTCGCA CAACAGAACCAAGGAGAAGCACCTGAACCCCAAGACATGAAAGTGGCCGAGGTGCTCT TTGATGCTGCCGACGCCAACGCCATTGAGGAGGTGAACCTGGCCTACGAGAATGTCAA GGAAGTCGATGGTCTGGATGTTTCCAAAGAAGGGACGGAAGCCTGGGAGGCCGCGATG AAGAGATACGATGAGAGGATCGACCGTGTGGAGACCCGCATCACCGCCCGCCTCCGAG ATCAGCTCGGCACGGCCAAGAATGCCAATGAGATGTTCAGGATTTTCTCCAGGTTCAA TGCACTGTTCGTCCGCCCACACATCCGAGGGGCCATTCGTGAATACCAGACCCAGCTG ATCCAACGTGTGAAAGATGACATCGAATCTCTGCACGACAAGTTCAAGGTCCAGTACC CGCAAAGCCAAGCTTGTAAAATGA Reverse Primer Amplified fragment is 696 bp long PCR Practical Example Genotyping Loa mice PCR Product Use agarose gels (typically 2% w/v) Incorporate ethidium bromide or other DNA dye PCR Product PCR Practical Example Genotyping Loa mice PCR Product Digestion Digestion with RsaI (GT|AC) at 37°C for 2 hrs 537bp 135bp 24bp 672bp Wt + Loa/Loa +/Loa + + + + + + + + PCR Practical Example PCR Product Digestion wt 672 bp 537 bp 135 bp 24 bp Loa/wt Loa/Loa Genotyping Loa mice Further PCR Examples • Quantitative (Real-Time) PCR (Q-PCR) • Reverse Transcription PCR (RT-PCR) • Multiplex-PCR • Helicase Dependant Amplification (HAD) END