Transcript Molecular Biology Databases - Computational Bioscience Program

Molecular Biology Databases
Lawrence Hunter, Ph.D.
Director, Computational Bioscience Program
University of Colorado School of Medicine
[email protected]
http://compbio.uchsc.edu/Hunter
Tour of the major
molecular biology databases
• A database is an indexed collection of
information
• There is a tremendous amount of information
about biomolecules in publicly available
databases.
• Today, we will just look at some of the main
databases and what kind of information they
contain.
Data about Databases
• Nucleic Acids research publishes an annual database
issue. 2009 issue lists 1170 editorially selected
databases (link on course web site)
• Small excerpt from the A's:
– AARSDB: Aminoacyl-tRNA synthetase sequences
– ABCdb: ABC transporters
– AceDB: C. elegans, S. pombe, and human sequences and
genomic information
– ACTIVITY: Functional DNA/RNA site activity
– ALFRED: Allele frequencies and DNA polymorphisms
Located Sequence Features
• Indexing relevant data isn’t always easy
– Naming schemes are always in flux, vary across
communities, and are often controversial.
– Descriptions of phenotypes are very difficult to standardize
(even many clinical ones)
• Genome sequences provide a clear reference
– A “located sequence feature” (place on a chromosome) is
unambiguous and biologically meaningful
– Closely related to the molecular concept of a gene.
What can be discovered about a
gene by a database search?
• Best to have specific informational goals:
– Evolutionary information: homologous genes, taxonomic
distributions, allele frequencies, synteny, etc.
– Genomic information: chromosomal location, introns,
UTRs, regulatory regions, shared domains, etc.
– Structural information: associated protein structures, fold
types, structural domains
– Expression information: expression specific to particular
tissues, developmental stages, phenotypes, diseases, etc.
– Functional information: enzymatic/molecular function,
pathway/cellular role, localization, role in diseases
Using a database
• How to get information out of a database:
– Summaries: how many entries, average or extreme
values; rates of change, most recent entries, etc.
– Browsing: getting a sense of the kind and quality of
information available, e.g. checking familiar records
– Search: looking for specific, predefined information
• “Key” to searching a database:
– Must identify the element(s) of the database that are of
interest somehow:
• Gene name, symbol, location or other identifying information.
• Sequences of genes, mRNAs, proteins, etc.
• A crossreference from another database or database generated id.
Searching for information
about genes and their products
• Gene and gene product databases are often
organized by sequence
– Genomic sequence encodes all traits of an organism.
– Gene products are uniquely described by their sequences.
– Similar sequences among biomolecules indicates both
similar function and an evolutionary relationship
• Macromolecular sequences provide biologically
meaningful keys for searching databases
Searching sequence databases
• Starting from a sequence alone, find information
about it
• Many kinds & sources of input sequences
– Genomic, expressed, protein (amino acid vs. nucleic acid)
– Complete or fragmentary sequences
• Goal is to retrieve a set of similar sequences.
– Exact matches are rare, and not always interesting
– Both small differences (mutations) and large (not required
for function) within “similar” sequences can be biologically
important.
What might we want
to know about a sequence?
• Is this sequence similar to any known genes? How
close is the best match? Significance?
• What do we know about that gene?
– Genomic (chromosomal location, allelic information,
regulatory regions, etc.)
– Structural (known structure? structural domains? etc.)
– Functional (molecular, cellular & disease)
• Evolutionary information:
– Is this gene found in other organisms?
– What is its taxonomic tree?
NCBI and Entrez
• One of the most useful and comprehensive database
collections is the NCBI, part of the National Library
of Medicine.
– Home to GenBank, PubMed & many other familiar DBs.
• NCBI provides interesting summaries, browsers, and
search tools
• Entrez is their database search interface
http://www.ncbi.nlm.nih.gov/Entrez
• Can search on gene names, chromosomal location,
diseases, articles, keywords...
BLAST:
Searching with a sequence
• Goals is to find other sequences that are more
similar to the query than would be expected by
chance (and therefore are likely homologous).
• Can start with nucleotide or amino acid sequence,
and search for either (or both)
• Many options
– E.g. ignore low information (repetitive) sequence, set
significance critical value
– Defaults are not always appropriate: READ THE NCBI
EDUCATION PAGES!
Main BLAST page
A demonstration sequence
atgcacttgagcagggaagaaatccacaaggactcaccagtctcctggtctgcagagaagacagaatcaacatgagcacagcaggaaaagtaa
tcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagttcgtatt
aagatggtggctgtaggaatctgtggcacagatgaccacgtggttagtggtaccatggtgaccccacttcctgtgattttaggccatgaggcagc
cggcatcgtggagagtgttggagaaggggtgactacagtcaaaccaggtgataaagtcatcccactcgctattcctcagtgtggaaaatgcaga
atttgtaaaaacccggagagcaactactgcttgaaaaacgatgtaagcaatcctcaggggaccctgcaggatggcaccagcaggttcacctgc
aggaggaagcccatccaccacttccttggcatcagcaccttctcacagtacacagtggtggatgaaaatgcagtagccaaaattgatgcagcct
cgcctctagagaaagtctgtctcattggctgtggattttcaactggttatgggtctgcagtcaatgttgccaaggtcaccccaggctctacctgtg
ctgtgtttggcctgggaggggtcggcctatctgctattatgggctgtaaagcagctggggcagccagaatcattgcggtggacatcaacaaggac
aaatttgcaaaggccaaagagttgggtgccactgaatgcatcaaccctcaagactacaagaaacccatccaggaggtgctaaaggaaatgact
gatggaggtgtggatttttcatttgaagtcatcggtcggcttgacaccatgatggcttccctgttatgttgtcatgaggcatgtggcacaagtgtca
tcgtaggggtacctcctgattcccaaaacctctcaatgaaccctatgctgctactgactggacgtacctggaagggagctattcttggtggcttta
aaagtaaagaatgtgtcccaaaacttgtggctgattttatggctaagaagttttcattggatgcattaataacccatgttttaccttttgaaaaaat
aaatgaaggatttgacctgcttcactctgggaaaagtatccgtaccattctgatgttttgagacaatacagatgttttcccttgtggcagtcttcag
cctcctctaccctacatgatctggagcaacagctgggaaatatcattaattctgctcatcacagattttatcaataaattacatttgggggctttc
caaagaaatggaaattgatgtaaaattatttttcaagcaaatgtttaaaatccaaatgagaactaaataaagtgttgaacatcagctggggaattg
aagccaataaaccttccttcttaaccatt
• Major choices:
– Translation
– Database
– Filters
– Restrictions
– Matrix
Formatted blast output
Close hit: Macaque ADH alpha
Distant hit:
L-threonine 3-dehydrogenase
from a thermophilic bacterium
Parameters
Click on:
…
Taxonomy report
(link from “Results of BLAST” page)
What did we just do?
• Identify loci (genes) associated with the
sequence. Input was human Alcohol
Dehydrogenase 1A
• For each particular “hit”, we can look at that
sequence and its alignment in more detail.
• See similar sequences, and the organisms in
which they are found.
• But there’s much more that can be found on
these genes, even just inside NCBI…
Blink: Precomputed blast
Conserved domains
NCBI version of KEGG & EcoCyc
More from Entrez Gene
And more…
PubMed
Gene Expression
Detailed expression
information
Genome map view
OMIM
NCBI is not all there is...
• Links to non-NCBI databases (see also “Link Out”)
–
–
–
–
–
Reactome for pathways (also KEGG)
HGNC for nomenclature
HPRD protein information
Regulatory / binding site DBs (e.g. CREB; some not linked)
IHOP (information hyperlinked over proteins)
• Other important gene/protein resources not linked:
–
–
–
–
–
UniProt (most carefully annotated)
PDB (main macromolecular structure repository)
UCSC (best genome viewer & many useful ‘tracks’)
DIP / MINT (protein-protein interactions)
More: InterPro, MetaCyc, Enzyme, etc. etc.
Gene Names (not easy!)
Protein reference db
…
…
Take home messages
• There are a lot of molecular biology databases,
containing a lot of valuable information
• Not even the best databases have everything (or the
best of everything)
• These databases are moderately well cross-linked,
and there are “linker” databases
• Sequence is a good identifier, maybe even better
than gene name!
Homework
•
•
Pick a favorite gene (or, if you don’t know any, how about
looking up one of my favorites, PPAR-Delta) and gather
information about it from at least five distinct resources.
Readings:
– Nucleic Acids Research online Molecular Biology
Database Collection in 2009
Nucl. Acids Res. 2009 37: D1-D4
doi:10.1093/nar/gkn942
• also, browse some of the entries themselves.
– NCBI tutorial, Entrez: Making use of its power.