Transcript Gel Electrophoresis

Syllabus Notes 3.4
3.4.1 State that PCR (polymerase chain reaction) copies
and amplifies minute quantities of nucleic acid.
3.4.2 State that gel electrophoresis involves the
separation of fragmented pieces of DNA according to
their charge and size.
3.4.3 State that gel electrophoresis of DNA is used in DNA
profiling.
Samurai Pizza Cats
Hour 2’s Random Show of the Day
Gel Electrophoresis, DNA Technology:
More than police justice
DNA Technology
Forensics
Gene Therapy
Genetic Engineering
Rabbit, mice and fish with the firefly
‘glow gene’ luciferase added.
Before Electrophoresis: Mate Crosses
Old fashioned methods of genetic engineering yielded things
like the liger, male lion + female tiger:
Before Electrophoresis: Landmarks
Genetically engineered insulin
used/approved-1982
1978-Invitro-Fertilization led to a
baby
Genetically engineered
organisms began to be
patented in 1981
Before Electrophoresis: More Landmarks
1992: FlavrSavr tomato,
engineered to ripen/rot
slower. Company is now
with Monsanto.
1997: First mammal cloned
(Dolly the sheep)
1998: Cloning of stem
cells (cells that are not
differentiated yet) led
to tissue regeneration,
and organ culture
Before Electrophoresis: More Landmarks
1986: DNA fingerprinting developed
by Alec Jeffreys
1990: Human Genome Project
launched. Goal: code the entire
human genome by 2005 (done
way ahead of schedule – 2000.)
1989: Bacteria with plasmids
that can digest oil are used to
clean up the Exxon Valdez oil
spill.
Electrophoresis: The Basics
Procedure used to separate
molecules – most
commonly proteins and
nucleic acids.
Uses a gel and an electric
current to separate
molecules by size or
charge.
http://learn.genetics.utah.edu/units/biotech/gel/
Electrophoresis: How & why it works
(–)
Phosphate groups make
nucleic acids negatively
charged.
In an electric field, the
negative anode repels
them and the positive
cathode attracts them.
Smaller fragments move
farther and faster than
slower, larger fragments.
Electrophoresis: Good to know
kb = kilobase-pairs, or
1,000 base pairs
It is used to describe the
number of base-pairs in
the DNA fragments.
Example:
4.36 kb = 4,360 base-pairs
Smaller fragments are
further down than large
fragments.
Electrophoresis: Restriction Enzymes
If someone’s DNA is cut with a restriction enzyme, it
will make fragments specific to that individual.
EcorI, a commonly used restriction enzyme, cuts
where ever GAATTC is found.
We may find this region:
5 times in an earthworm; or
15 times in a bacteria.
We get different lengths between individuals as well
as different numbers of fragments.
Electrophoresis: Restriction Enzymes
Ecor I Restriction Enzyme cuts between the ‘G’ and the ‘A’
Whenever the sequence is ‘GAATTC’
Makes ‘sticky ends’
Electrophoresis: Restriction Enzymes
This is the concept behind adding a gene from one organism
into another one.
If you cut out a gene using a restriction enzyme, you can
make an opening in the DNA of the new organism with the
same restriction enzyme.
Electrophoresis: Restriction Enzymes
SmaI cuts between the ‘C’ and the ‘G’ whenever ‘CCC|GGG’
are in a sequence. How does this make a ‘blunt’ end?
AATTGGAACCCGGGTTCCAAG
TTAACCTTGGGCCCAAGGTTC
Electrophoresis: Restriction Enzymes
There are a bunch of different
enzymes we can use, each
cutting in their own unique
way.
If we cut with the same DNA
with different enzymes, we’ll
get a picture like this one.
Electrophoresis: RFLPs
“Restriction Fragment Length
Polymorphism”
Definition: a technique in which
organisms may be differentiated by
analysis of patterns by the cleavage
of their DNA.
Two organisms differing in distances
between cleavage sites will produce
different length fragments!
Similarities in patterns generated can be
used to differentiate the two.
Electrophoresis: CSI SW
We can match identities by
putting multiple people on the
same gel.
Electrophoresis: CSI SW – Ain’t yo daddy…
In each of these cases, is the alleged father really the
father? (These gel have been simplified.)
Remember: each parent donates ½ the genes!
Electrophoresis: Activity
Carefully follow the instructions to the restriction enzyme
activity. Only do Part One!
Turn in:
• Answers to the lab questions
• Your labeled and cut DNA slips (staple them to your
answer sheet)
Reminder:
• Make-up point work is due tomorrow (Friday)