Protein Synthesis - Pullman Education Portal
Download
Report
Transcript Protein Synthesis - Pullman Education Portal
Translation
• What is the Genetic Code, and how is it read?
– Our 1st step
• Understanding Vocabulary – Define & Draw these…
– Polypeptide
-- Genetic Code
– Codon
--Translation
– Anticodon
-- Gene Expression
– Amino Acid
-- Heredity
Protein Synthesis
mRNA to Protein
Translation
Key Question
• As a group, try to figure out this key question:
– What is meant by “The Genetic Code,” and how is
it “read”?
Translation
• What is Translation =
• What is The Genetic Code
– Language of 4 letters in 3-letter words.
• Called Codons
Translation
• How many codons are possible?
– 64
Translation
• What do codons code for?
– Code for Amino Acids
Translation
• As a group, complete the following:
– Be ready to talk about this and possibly draw a
diagram of your answer:
• What is the Process of Translation?
• Where does Translation occur?
• Who are the “major players” of translation and what
are their roles?
Translation
• Where does Translation always start?
– Start Codon
• AUG is always the Start Codon
• Corresponds with Met (Methionine)
• Where does Translation end?
– Stop Codons
• UAA, UAG, UGG
• Why are these stop codons?
– Don’t correspond with any Amino Acid
Translation
Review so far:
• Where does Translation Occur?
– Ribosome
• What does the Ribosome do?
– Uses the sequence of mRNA codons to assemble
Amino Acids into Polypeptide Chains (Proteins)
• How do Ribosomes do this?
– Lets look at this…
Steps of Translation
• Depending on the textbook, there are 5-6
steps of translation:
– What are the steps of translation?
• Draw a picture representing each step…
Steps of Translation
Lettuce Review…
Step 1
• mRNA attaches to Ribosome
• Ribosome reads Start Codon
Steps of Translation
Step 2
• Ribosome brings in appropriate tRNA
– How does this happen?
Steps of Translation
Step 2 cont.
• tRNA
– Shaped specifically
• Anticodon –
– mRNA attachment
site
– Complimentary
sequence to mRNA
codon
• Amino Acid site
Steps of Translation
Step 3
• Ribosome completes it’s structure
• Ribosome has 3 Important Sites…
Steps of Translation
• Ribosome Structure
– A site
• Active Site –
– Where “reading”
occurs
– P Site
• Peptide Site – Where amino acids
are joined together
– E Site
• Exit Site – Where “empty”
tRNA’s leave to get
more amino acids
Steps of Translation
Step 4
• Ribosome Moves & reads next codon
• Ribosome brings in Appropriate AA.
• Called = Elongation
Steps of Translation
Step 5
• Peptide bond is formed
• Ribosome reads next codon
• Releases 1st tRNA
Steps of Translation
Step 6
• Step 4 & 5 are repeated until Termination
Heredity
• Gene Expression
– The Central Dogma of molecular biology is:
• Information is transferred from
DNA
RNA
Protein
– Proteins are the “Workers” of organisms
• Produce pigment
• enzymes that control reproduction
– Proteins are:
• Microscopic tools, each specifically designed to build or
operate a component of a living cell
• Important players in producing an organism’s traits
How Does a Cell Interpret Codons?
Write the following gene on your paper.
TACGACAAGTCCACAATCCAT
1. From Left to Right, write the sequence of the mRNA
molecule transcribed from this gene.
2. Translate the mRNA into it’s tRNA sequences.
3. Using the table of anti-codons, write the amino acid
sequence.
4. Repeat step 3, reading the codons from right to left.
5. Analyze & Conclude:
1. Why did steps 3 & 4 produce different polypeptides?
2. Do cells usually decode mRNA’s in one direction only or
in either direction?
tRNA anti-codons
Translation Review
Complete on a Separate Piece of Paper
1. How does a cell interpret the genetic code?
2. What are codons and anticodons?
3. Using the table of anti-codons, identify the amino
acids specified by the codons UGG, AAG, and UGC
4. What happens during translation?
5. How is protein synthesis different then DNA
replication?
6. Why is the genetic code considered universal?
7. What does the term gene expression mean?
8. In what way does controlling the proteins in an
organism control the organisms characteristics?
Due Friday 5/10
Answers will be posted on the PEP server after the due date.