Transcript homeotic genes - Faculty Bennington

MUTANTS
genetic variation in human development
Lecture 6
Fall 2006
Bennington College
homeotic genes all have a common amino acid sequence that confers
the necessary structure to bind to DNA and activate or repress gene
transcription - this sequence is called the homeobox
homeotic genes specify the particular developmental fate of body parts
example:
"build mouthparts here (and not everywhere)",
and "put genitalia here (not over there)"
Homeobox and Homeodomain:
The homeobox is a 180 base pair sequence of DNA found in many regulatory genes.
The homeodomain is the 60 amino acid stretch that corresponds to the
translated homeobox. This part of the protein is the DNA binding sequence.
DNA consists of 4 possible bases/nucleotides - GCAT
A sequence of DNA is read 3 bases at a time when being
converted to amino acids (and ultimately protein)
for a given DNA sequence:
ATGCCGCATCCAAGGGTCGACGTATTTCTTGTGGATCATCGGAGACGA
TACGGCGTAGGTTCCCAGCTGCATAAAGAACACCTAGTAGCCTCTGCT
would be the transcribed mRNA sequence
and
M P H P R V D V F L
is the resulting sequence of amino acids
V
D
H
R
R
R
Translation of messenger RNA into protein
Amino Acid
tRNA
anti-codon
mRNA
codon
To initiate gene expression (or in some cases, to prevent gene expression),
regulatory proteins (homeobox proteins and other transcription factors)
bind to DNA upstream of the start of the target gene at regulatory elements.
The homeodomain region of homeotic genes folds into three helices
formed such that helix 3 fit perfectly into a groove formed by the DNA
spiral, and the amino acids in homeodomain regions specify binding to
particular sequences in the DNA.
the homeodomain helix 3
likes to bind to TAAT
The homeodomain sequence is highly conserved. The DNA sequence is
roughly 75% homologous when comparing different Hox genes within the fly;
comparisons of just the homeodomain sequence show even higher homology
(most nucleotide differences conserve the amino acid encoded)
K (lysine)
Q (glutamine)
The prevailing myth that human deformity
results from some moral failing
-“mark of Cain” philosophy…
With our modern scientific knowledge,
clearly has no basis in fact - but sometimes
events conspire to make you wonder…
The 1680’s in Scotland came to be known as “The Killing Time”
England, following up on what King Charles II started, was still
trying to impose the English Church system on Scotland.
Dissenters were not tolerated and were put to death - often in
spectacular and horrific fashion (to, of course, discourage other
potential dissenters…)
Thus was the fate of elderly Margaret McLauchlan and youthful Margaret Wilson
(her younger sister would have suffered the same fate but her life was purchased)
it was demanded of them, as a test of their loyalty, that they should swear the
abjuration oath. This was an oath rejecting a manifesto published by the Society
People, or the Cameronians, on the 8th of November 1684, entitled 'The Apologetic
Declaration and Admonitory Vindication of the True Presbyterians of the Church of
Scotland, especially anent Intelligencers and Informers.'
Sentenced to death by “drowning at the stake”
Supposedly, the officer who last thrust the younger Margaret
into the waters was named Bell. His wife soon thereafter
gave birth to a child with ectrodactyly (split-hand split-foot syndrome)
his descendants thus came to be known as the “cleppie Bells”
(why not parten Bells? I need a linguist to explain this to me…)
Ectrodactyly is dominantly inherited
but can also be chemically induced (at least in rats) by environmental factors:
retinoic acid, cadmium, hydroxyurea, cytarabine, methotrexate, ethanol,
caffeine, cocaine, valproic acid, acetazolamide and methoxyacetic acid
Ectrodactyly is only one of many possible
things that can go wrong during limb development
well-formed limbs are not essential for viability
(and are quite easily compensated for - especially
if they were never there to begin with)
Acheiropodia
Ianakiev,P. et al., Acheiropodia Is Caused by a Genomic Deletion in
C7orf2, the Human Orthologue of the Lmbr1 Gene, Am. J. Hum. Genet.,
v.68: 38-45, 2001.
phocomelia (tetraphocomelia)
Phamous Phocomelia-ites
Carl Hermann Unthan
born in East Prussia
1848-1928
Phamous Phocomelia-ites
Marc Cazotte (Pepin)
born in Paris
1757-1801
Limb development - Buds, bones, and beyond…
Day 26
Day 28
Day 26
Day 28
the limb bud is capped with cells comprising
an Apical Ectodermal Ridge (AER) discovered by John Saunders in 1948
The AER is rich in signalling molecules especially FGFs
FGF = Fibroblast Growth Factor = A family of protein growth factors
involved in new blood vessel formation, wound repair, lung maturation, and
the development of skeletal muscle, specific lineages of blood cells and bone
marrow. FGFs are recognized by a family of cell surface receptors that have the
ability to catalyze reactions inside the cell after they are activated by the FGFs.
Effects of mucking about with the AER
Induction of ectopic limb
with FGF-soaked bead
Pascal H.G. Duijf, Hans van Bokhoven* and Han G. Brunner
Pathogenesis of split-hand/split-foot malformation
Human Molecular Genetics, 2003, Vol. 12, Review Issue 1 R51-R60
Figure 1. The ectrodactyly phenotype and underlying AER defect. (A) Clinical variability of ectrodactyly.
(B) Normal development of the autopod (top) and ectrodactyly malformation (bottom).
Ectrodactyly is caused by a failure to maintain median AER activity (red) in the developing
limb bud (left), leading to the absence of the central rays (right). (Future) positions of digits
1–5 are indicated. AER, apical ectodermal ridge; PZ, progress zone; ZPA, zone of polarizing activity.
For correct limb and digit development, three specialized
cell clusters are of primary importance:
the apical ectodermal ridge (AER), the progress zone (PZ),
and the zone of polarizing activity (ZPA).
These groups of cells produce signalling molecules that determine
the fate of neighbouring cells by instructing them to remain undifferentiated,
to proliferate, or to differentiate into a particular cell type.
effects of thalidomide on human fetus development
Thalidomide effects on fetal marmosets
on the right, fetus of a marmoset treated with 25 mg/kg body
weight thalidomide between days 38 and 46 of pregnancy