Transcript Section J Analysis and Uses of Cloned DNA

Section J
Analysis and Uses of Cloned DNA
J1
J2
J3
J4
J5
J6
Characterization of clones
Nucleic Acid Sequencing
Polymerase chain reaction
Organization of cloned genes
Mutagenesis of cloned genes
Applications of cloning
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
J 1 Characterization of clones
•
•
•
•
•
Characterization
Restriction mapping
Partial digestion
Labeling nucleic acid
Southern and northern blotting
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Characterization
This process of characterizing a genomic or cDNA clone
include: the  size,  restriction map,  transcribed
sequence,  position,  polarity and  the sequencing
of the insert DNA.
More experiments must be performed to verify that:
• Predicted gene is actually transcribed into mRNA in
some cells;
• A expression gene: a predicted-size protein may be
made in vivo;
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Restriction mapping
1.
2.
Size: The insert can be determined by agarose gel
electrophoresis using markers. It is best to digest the
DNA with a restriction enzyme
Orientation of the insert: It can be determined by
digesting with two restriction enzymes. Fig. la
illustrates the process for a EMBL3 genomic clone.
(long arm+insert+short arm)
19 kb
Sal1 15 kb Sal1 9 kb
Sal I
HindIII HindIII
HindIII
Hand III
21 kb
7 kb
SH
11 kb
H
S
4kb
H
Sal I + Hand III
2kb
Section J: Analysis and uses of cloned genes
6kb 5kb
Yang Xu, College of Life Sciences
Partial digestion
1. End-labeled DNA: Adding a
radioactive nucleotide to one end of
the DNA fragment producing an
end-labeled molecule.
2. Total digestion of the unlabeled 10kb
fragment with EcoRI gives 1, 2, 3
and 4kb pieces.
3. Partial digestion, with low EcoRI
concentration, which can generate all
possible fragments, shows additional
bands of 6, 7 and 10 kb. Note 3, 4
and 6 kb can be generated in more
than one way.
4. Auto-radiographed: if the partial
digestion lane is auto-radiographed
to show up only those end-labeled
molecules, the pattern is 3, 4, 6 and
10 kb. This allows the map shown
(size and orientation).
Section J: Analysis and uses of cloned genes
3kb
1k 2kb
E E
Total
4kb
3kb
2kb
4kb
E
Partial Auto-radio
10kb
6kb
1kb
Yang Xu, College of Life Sciences
Labeling nucleic acid
Classification: DNA and RNA molecules can either be labeled:
• End labeling: labeling at their ends
– 5'-End labeling: using polynucleotide kinase to add a radioactive
phosphate to 5’-end of nucleic acids.
– 3'-End labeling:  using terminal transferase to add one or more
nucleotides to the 3’-end of nucleic acids or  using polymerases to
“fill in” the 3'-end with [-32P] dCTP.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Labeling nucleic acid
• Uniform labeling: throughout the fragments
– dsDNA is treated with a tiny amount of DNase I, which introduces
random nicks along both strands. DNA polymerase I can find these nicks
and remove dNTPs, then incorporate radioactive nucleotides.
• Strand-specific labeling: one strand of the dsDNA.
– Strand-specific DNA probes: for example, using single-stranded DNA
obtained after cloning in an M13 phage vector;
– Strand-specific RNA probes: using RNA polymerases such as SP6, T7 or
T3 phage polymerases (see Topic H1).
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Southern and northern blotting-I
Function and Name: Using labeled probe to hybridize and detect which
DNA (or RNA) molecule on an agarose gel. Southern blots is for
DNA and Northern blots is for RNA. The former is named after its
inventor and the latter was named from the former one.
Procedure:
1. Agarose gel electrophoresis: to separate
the nucleic acid molecules;
2. Denatured with alkali: only for DNA;
3. Transfer: then transferred the molecules
to a nylon or nitrocellulose membrane.
This is done by  capillary action, 
electrotransfer,  vacuum transfer;
4. Hybridization: the nucleic acid must be
hybridized to labeled probe;
5. Washing and baking: washing
extensively and baking
6. Detection: usually by auto-radiography
or antibody methods
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Southern and northern blotting-II
Definition: The stringency is stability of the
hybridized molecules. If the probe and target
gene are 100% complementary in sequence, then
we say this is a high stringency hybridization.
• High stringency: high temperature and low salt is more stringent,
as only perfectly matched hybrids will be stable;
• Low stringency: If the stringency is too low, then the probe may
lose its specialty, and bind to too many sequences.
Washing temperature: Washing step should be carried out at 12C
below the theoretical melting temperature (Tm) of the probe and
target sequences, using the formula:
Tm = 69.3C + 0.41 [% (G + C)] – 650/L
where L is the length of the probe molecule.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Southern and northern blotting-III
Southern blots:  to find which parts of the genomic
clone match a cDNA probe;  If the Southern
blot contains genomic DNA fragments from the
whole genome, the probe will give information
about the size of the fragment;  and how many
copies of the gene are present in the genome.
Northern blots:  to find the size of the mRNA and
any precursors;  to determine if a cDNA clone
used as a probe is full-length;  to determine if it
is a family member of related transcripts;  to
identify if a genomic clone has regions
transcribed;  to find where these transcripts are
made (what tissues the RNA is from).
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
J 2 Nucleic Acid Sequencing
• The two main methods of DNA sequencing are (1) Maxam’s method:
the end-labeled DNA is subjected to base-specific cleavage reactions
prior to gel separation; (2) Sanger’s method: to uses di-dNTP as
chain terminators to produce a ladder of molecules generated by
polymerase extension of a primer.
• A set of four RNases that cleave 3' to specific nucleotides are used to
produce a ladder of fragments from end-labeled RNA. The PAGE
analysis allows the sequence to be read.
• Newly determined DNA, RNA and protein sequences are entered
into databases (EMBL and GenBank).
• Special computer software is used to search nucleic acid and protein
sequences for the presence of patterns (e.g. restriction mapping).
• The entire genome sequences of several organisms have been
determined (viruses, bacteria and yeast, some plants and human).
Often a genetic map is first produced to aid the project.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
J 3 Polymerase chain reaction
• PCR
• The PCR cycle
• Template
• Primers
• Enzymes
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
PCR
Definition: If a pair of oligo-nucleotide primers can be designed to
be complementary to a target DNA molecule such that they can
be extended by a DNA polymerase towards each other, then the
template bounded by the primers can be greatly amplified by
carrying out cycles of  denaturation,  primer annealing and
 polymerization. This process is known as the polymerase chain
reaction (PCR).
The discovery of
thermostable DNA
polymerases has made
the steps in the PCR
cycle much more
convenient.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
The PCR cycle
Template
Primers
Taq polymerase
1. Denaturation: 95C (60s);
2. Annealing: 55C (30s)
3. Polymerization: 72C
(60-90s) which will use
up dNTPs in the reaction
mix and requires Mg2+.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
The PCR cycle
• Molecules with correct length;
• At the end of cycle 2, see Fig.1, some newly synthesized
molecules with correct length exist. In subsequent cycles,
these soon outnumber the original target molecules and
increase two-fold with each cycle.
• If PCR was 100% efficient, one pair of template,
PCR with 20 cycles are as an example:
 Molecules with non-correct length: 20 ×2 = 40 ssDNA;
 Molecules with correct length: 220 - 40 = 2,097,112
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Template
• Number of the templates: It has been demonstrated that PCR
can sometimes amplify as little as one molecule of starting
template.
• Source of the template: In principle, any source of DNA that
provides one or more target molecules can be used as a
template for PCR. This includes DNA prepared:
– from blood, sperm or any other tissue;
– from older forensic specimens;
– from ancient biological samples;
– in the laboratory from bacterial colonies or phage plaques as
well as purified DNA.
• Requirement of the template: Whatever the source of template
DNA, PCR can only be applied if some sequence information
is known in advance so that primers can be designed.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Primers
• Requirements of PCR primers:  They need to be about 18-30 nt long
and  to have similar G+C contents so that they anneal to
complementary sequences at similar temperatures.
• Length of target sequences:  Short target sequences amplify more
easily, so often this distance is less than 500 bp, but, with optimization,
PCR can amplify fragments over 10 kb in length.
• Primer design:
– The region to be amplified should be inspected for two sequences
of  about 20 nt with a  similar G+C content;
– If the PCR product is used to cloning, the primers had better
include the same restriction sites within the 5'-ends.
– They are designed to anneal on opposite strands of the target
sequence so that they will be extended towards each other by
addition of nucleotides to their 3'-ends.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Enzymes
Source: Thermo-stable DNA polymerases
which have been isolated and cloned
from a number of thermo-philic bacteria
are used for PCR.
Taq polymerase: The most common is Taq
polymerase from Thermus aquaticus.
• Feature: It survives during the denaturation step at 95 C for 12 min, having a half-life of more than 2 h at this temperature.
• Disadvantages: Because it lacks 3' to 5' proofreading
exonuclease activity (see Topics F1 and G1, Table1), Taq
polymerase is known to introduce errors when it copies DNA
roughly one per 250 nt polymerized. For this reason, other
thermostable DNA polymerases with greater accuracy are used
for certain applications.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
J 4 Organization of cloned genes
•
•
•
•
•
Organization
Mapping cDNA on genomic DNA
Primer extension
DNase I footprinting
Reporter gene
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
cDNA Organization
Organization: cDNA clones have a defined organization, especially
those synthesized using oligo (dT) as primer.
1. Start codon: If the cDNA clone is complete, it must have an
ATG start codon;
2. ORF: Open reading frame (ORF);
3. A residues: Usually a run of A residues is present at cDNA 3'end;
4. Stop codon for transcription;
5. Regulate sequences of transcription.
Absent Sequences of the cDNA organization:
•
Introns;
•
Sequences upstream of the transcription start site;
•
Sequences downstream of the 3‘-processing site.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Mapping cDNA on genomic DNA
Southern blotting: If restriction maps are
available for both the genomic and its
cDNA clones, an important experiment
is to run a Southern blot using all or
part of the cDNA as a probe.
Using all cDNA as probe: will show  which genomic restriction
fragments contain sequences also present in the cDNA.
 These cDNAs may not be adjacent fragments in the restriction
map if large introns are present.
Using one end of a cDNA as a probe: will indicate
 The polarity of the gene in the genomic clone.
 Some restriction sites are common in both clones but may be
different distances apart. These can often help to determine the
organization of the genomic clone.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Primer extension
Purpose: This technique can determine the length of the 5'- and
3'-end of RNA transcripts.
Procedure: (p156 Fig. 2)
1. RNA-DNA hybridization: The probe is an antisense DNA.
Annealing DNA primer, to form the RNA-DNA hybrids.
2. Primer extension: Using reverse transcriptase to extend the DNA
primer in the 5' to 3' direction, from the site where it base-pairs on the
target to where the polymerase dissociates at the end of the template.
3. PAGE analysis: The primer extension product is run on a gel next to
size markers and/or a sequence ladder from which its length can be
established.
Polymerase
+ dNTP
5’
RNA preparation
DNA primer
PAGE analysis
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
DNase I footprinting
Problem and solution:  Although gel analysis shows that a protein
is binding to a DNA, it does not provide the sequence
information of the binding site.  DNase footprinting shows the
actual region of sequence with which the protein bends.
1. End-labeled DNA
2. Protein binding
3. DNase I partial
digestion
4. PAGE Analysis
5. Auto-radiography
- DNA binding Protein
Section J: Analysis and uses of cloned genes
+ DNA binding Protein
Yang Xu, College of Life Sciences
Reporter gene
Purpose: This technique can test
if the promoter works or not.
Mechanism: When the promoter
has been identified by
sequencing, Sl mapping and/
or DNA-protein binding
experiments, it is common to
attach the promoter region to
a reporter gene, to study its
action and verify that the
promoter has the properties
being ascribed to it.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
J 5 Mutagenesis of cloned genes
• Deletion mutagenesis
• Site-directed mutagenesis
• PCR mutanenesis
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Deletion mutagenesis
• Progressively deleting DNA from one end is very useful for
finding the function of particular sequences.
EcoRI
SacI
KpnI
XmaI BamHI
XbaI
SalI
PstI
SphI
HindIII
GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT
CTTAAGCTCGAGCCATGGGCCCCTAGGAGATCTCAGCTGGACGTCCGTACGTTCGAA
insertion
MCS
SacI and bamH1
GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT
CTTAAGCTCGAGCCATGGGCCCCTAGGAGATCTCAGCTGGACGTCCGTACGTTCGAA
GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT
CTTAAGCTCGAGCCATGGGCCCCTAGGAGATCTCAGCTGGACGTCCGTACGTTCGAA
GAATTCG
CTTAAGC
Section J: Analysis and uses of cloned genes
Transcription and expression
Yang Xu, College of Life Sciences
Site-directed mutagenesis
Function: It is very useful to be able to change just one, or a few
specific nucleotides in a sequence to test a hypothesis. Suspected
amino acids in a protein could be changed by altering the cDNA
sequence so that by a one nucleotide change an amino acid, the
effect is examined by testing the function of the mutant protein.
Methods:
 Single-stranded template: Originally, site-directed mutagenesis
used this method (it was created by subcloning in M13) and a
primer oligonucleotide with the desired mutation in it. The
primer was annealed to the template and then extended using a
DNA polymerase, ligated using DNA ligase to seal the nick and
the mismatched duplex transformed into bacteria.
 PCR mutanenesis: Because single-stranded template method is
not very efficient and because subcloning in M13 to prepare
single-stranded DNA is time consuming, much site-directed
mutagenesis is now carried out using the polymerase chain
reaction (PCR),
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
J 6 Applications of cloning
•
•
•
•
•
•
Applications
Recombinant protein
Genetically modified organisms
DNA fingerprinting
Medical diagnosis
Gene therapy
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Applications
Importance of gene cloning: The gene cloning has made
a great impact on the speed of biological research and
it is increasing its presence in several areas of everyday
life.
Applications: These include:
– recombinant protein production;
– genetically modified organisms;
– DNA fingerprinting;
– diagnostic kits
– gene therapy
This topic describes some of these applications.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Recombinant protein production
Purpose: Some proteins that are known to be missing or defective in
various disorders. These include growth hormone, insulin,
interferon, blood clotting factor VIII and so on. Production of
protein from a cloned gene can solve these problems.
Main methods:
• In bacteria:  Initially, production in bacteria was the only way
available. cDNAs had to be linked to prokaryotic transcription and
translation signals and inserted into multi-copy plasmids. 
However, often the overproduced proteins were lacked eukaryotic
post-translational modifications.
• In eukaryotic cells:  Production in yeast or mammalian cell lines
has helped greatly.  For example, the human factor VIII protein,
which is administered to hemophiliacs (血友病), is produced in a
hamster cell line which has been transfected with a 186 kb human
genomic DNA fragment.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Genetically modified organisms
Definition: Genetically modified organisms (GMO) are created when
cloned genes are introduced into germ cells. In eukaryotes, if the
introduced genes are from another organism, the transgenic plants
or animals can be propagated by normal breeding.
Examples:
• Transgenic plants: One example is a
tomato that has had a gene of a ripening
enzyme inactivated. The strain of tomato
takes longer to soften.
• Transgenic sheep: They produce
valuable proteins in their milk. The
desired gene requires a sheep promoter
to be attached to ensure expression in
the mammary gland.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
DNA fingerprinting
Definition: The Southern blots of genomic DNA
with probes that recognize simple nucleotide
repeats gives a pattern that is unique to an
individual and can be used as a fingerprint.
Applications: For example
• Maternity and paternity testing in humans;
• To show pedigree in animals bred commercially.
Analysis:
• Some of these bands will be in common with
those of the mother and some with those of the
father. The different patterns in individuals at
each of these kinds of simple repeat.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Medical diagnosis
Background: A great variety of diseases arise from
mutation. In genetic disorders, individuals are born
with faulty genes that cause the symptoms of the
disorder. Many cancers arise due to spontaneous
mutations in somatic cells in genes whose normal role
is the regulation of cell growth.
Diagnostic kits: By using sequence information to design
PCR primers and probes, many diagnostic kits have
been developed to screen patients for these clinically
important mutations.
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences
Gene therapy
Definition: Attempts have been made to treat some
genetic disorders by delivering a normal copy of
the defective gene to patients. This is known as
gene therapy.
Examples of the methods:
• Defective virus: The gene can be cloned into a
defective virus used as a vector that can replicate
but not cause infection.
• Bone marrow transplant: For treating some
disorders, the bone marrow must be destroyed
and is replaced with treated cells that have had a
normal gene, or a protective gene, introduced.
Perspective: Gene therapy is in its infancy, but it
seems to have great potential.
Section J: Analysis and uses of cloned genes
P53 gene
therapy
Yang Xu, College of Life Sciences
That’s all for Section J
Section J: Analysis and uses of cloned genes
Yang Xu, College of Life Sciences