Evolution as Theory and Fact

Download Report

Transcript Evolution as Theory and Fact

Evidence of Evolution
The Tree of Life
• All living things share a common
ancestor.
• We can draw a Tree of Life to
show how every species is related.
• Evolution is the process by which
one species gives rise to another
and the Tree of Life grows
en.wikipedia.org/wiki/Image:Phylogenetic_tree.svg
Evolution as Theory and Fact
• Confusion sometimes arises as to
whether Evolution is a theory or a fact.
Actually it is both!
• The theory of Evolution deals with how
Evolution happens. Our understanding
of this process is always changing.
• Evolution is also a fact as there is a
huge amount of indisputable evidence
for its occurrence.
Rodin’s “The Thinker”
Theories of Evolution
Origin Myths/Cosmologies
Genesis (Western example)
Carl Sagan’s Universe Calendar
24 days = 1 billion years
1 second = 475 years
“Big Bang”
Milky Way
Solar System
Life on Earth
Humanlike Primates
January 1
May 1
September 9
September 25
Milky Way
December 31, 10:30pm
Theories of Evolution
Darwin and Wallace, 1850s
Evolution theory holds that
existing species of plants and
animals have emerged over
millions of years from simple
organisms.
Darwin, On the Origin of
Species, 1859
Charles Darwin
Theories of Evolution Darwin’s principle of natural selection
“Natural selection is the gradual process by which nature
selects the forms most fit to survive and reproduce in a
given environment.”
For natural selection to work on a given population, there
must be variety within that population and competition for
strategic resources.
The concept of natural selection argues that organisms
which have a better fit within their environmental niche will
reproduce more frequently than those organisms that fit less
well.
Theories of Evolution Random genetic drift is the loss of alleles from a
population's gene pool through chance.
Mutation introduces genetic variation into a
breeding population.
Gene flow occurs through interbreeding: the
transmission of genetic material from one population
to another. Gene flow decreases differences and
inhibits speciation, the formation of new species.
Theories of Evolution Mendel’s principle of inheritance, 1856
The science of genetics explains the origin of the
variety upon which natural selection operates.
By experimenting with successive generations of
pea plants, Mendel came to the conclusion that
heredity is determined by discrete particles, the
effects of which may disappear in one generation,
and reappear in the next.
Other Theories
Creationism accounts for biological diversity by referring to
the divine act of Creation as described in the book of Genesis
Catastrophism is a modified version of Creationism, which
accounts for the fossil record by positing divinely authored
worldwide disasters that wiped out the creatures represented in
the fossil record, who were then supplanted by newer, created
species.
Intelligent Design states that modern physics and cosmology
have uncovered evidence for intelligence in the structure of the
universe and this intelligence seems to act with us in mind and
that the universe as a whole shows evidence of design.
Evidence of Evolution
Early Primates
Prosimians (65mya)
Monkeys (35mya)
Apes (23mya)
Hominids (5mya)
Early Primates - Traits
Common physical primate traits:
Dense hair or fur covering
Warm-blooded
Live young
Suckle
Infant dependence
Common social primate traits:
Social life
Play
Observation and imitation
Pecking order
Common Primate Traits
Primate Family Tree
Crown lemur
Orangutan
Born from Primates?
‘Discovering Ardi’ and ‘Ardipithecus and
Human Evolution’ videos
(Discovery.com)
Biochemistry
• The basic similarity of all living things suggests
that they evolved from a single common ancestor.
• As we have already seen, all living things pass
on information from generation to generation
using the DNA molecule.
• All living things also use a molecule
called ATP to carry
energy around the
DNA for
Information organism.
Transfer
en.wikipedia.org/wiki/Image:ATP-xtal-3D-sticks.png
ATP for
Energy
Transfer
Similar Genes
HUMAN
CHIMPANZEE
GORILLA
CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA
CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
Genetic code of chimps and gorillas is almost identical to humans
• If evolution is true then we might also expect that closely
related organisms will be more similar to one another than more
distantly related organisms.
• Comparison of the human genetic code with that of other
organisms show that chimpanzees are nearly genetically identical
(differ by less than 1.2%) whereas the mouse differs by ≈15%.
Comparative Anatomy
• Similar comparisons can be made
based on anatomical evidence.
• The skeleton of humans and
gorillas are very similar suggesting
they shared a recent common
ancestor, but very different from the
more distantly related
woodlouse…
Human and Gorilla
yet all have a common
shared characteristic:
bilateral symmetry
Woodlouse
en.wikipedia.org/wiki/Image:Primatenskelett-drawing.jpg
Homology
The pentadactyl limb
is ancestral to all
vertebrates…
but modified for different uses
en.wikipedia.org/wiki/Image:Evolution_pl.png
Vestigial Structures
• As evolution progresses, some
structures get side-lined as they
are not longer of use; called
vestigial structures
• The coccyx is a much reduced
version of an ancestral tail,
was formerly adapted to aid
balance and climbing
The coccyx is a vestigial tail
• Another vestigial structure in
humans is the appendix.
en.wikipedia.org/wiki/Image:Illu_vertebral_column.jpg
Fossil Record
http://en.wikipedia.org/wiki/Geologic_time_scale
© World Health Org.
en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png
© NASA
origins
bacteria complex cells dinosaurs
humans
The fossil record shows a sequence from simple bacteria to
more complicated organisms through time and provides the most
compelling evidence for evolution.
Evolution of the modern horse
From Eohippus
(5 toes, > 1 foot,
size of a cat)
To Equus
(1 toe,
5 feet tall)
Evolution of the modern horse
Transitional fossils
• Many fossils show a clear
transition from one species,
or group, to another.
• Archaeopteryx was found
in Germany in 1861. It
share many characteristics
with both dinosaurs and
birds.
Archaeopteryx
en.wikipedia.org/wiki/Image:Archaeopteryx_lithographica_paris.JPG
• It provides good evidence
that birds arose from
dinosaur ancestors
Geography
Marsupials
• Geographic spread of
organisms also tells of
their past evolution.
• Marsupials occur in
two populations today
in the Americas and
Australia.
• This shows the group
evolved before the
continents drifted apart
evolution.berkeley.edu/evosite/lines/IVCexperiments.shtml
en.wikipedia.org/wiki/Image:Kangaroo_and_joey03.jpg
Antibiotic Resistance
Antibiotic Resistance
•This is an example of natural selection in
action. The antibiotic acts as an
environmental pressure. It weeds out
those bacteria with low resistance and
only those with high resistance survive
to reproduce.