Transcript Document
Genetic Engineering Biotechnology Regents Biology 2006-2007 We have been manipulating DNA for generations! Artificial breeding creating new breeds of animals & new crop plants to improve our food Regents Biology Animal breeding Regents Biology Breeding food plants “Descendants” of the wild mustard the “Cabbage family” Regents Biology Breeding food plants Evolution of modern corn (right) from ancestral teosinte (left). Regents Biology A Brave New World Regents Biology The code is universal Since all living organisms… use the same DNA use the same code book read their genes the same way Regents Biology TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT human genome CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA 3.2 billion bases CTAGCTACTGACTCATGATCCAGATCACTGAAACCCTA GATCGGGTACCTATTACAGTACGATCATCCGATCAGAT CATGCTAGTACATCGATCGATACTGCTACTGATCTAGC TCAATCAAACTCTTTTTGCATCATGATACTAGACTAGC TGACTGATCATGACTCTGATCCCGTAGATCGGGTACCT ATTACAGTACGATCATCCGATCAGATCATGCTAGTACA TCGATCGATACTGCTACTGATCTAGCTCAATCAAACTC TTTTTGCATCATGATACTAGACTAGCTGACTGATCATG ACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGA TCATCCGATCAGATCATGCTAGTACATCGATCGATACT Regents Biology Can we mix genes from one creature to another? YES! Regents Biology Mixing genes for medicine… Allowing organisms to produce new proteins bacteria producing human insulin bacteria producing human growth hormone Regents Biology How do we do mix genes? Genetic engineering find gene cut DNA in both organisms paste gene from one creature into other creature’s DNA insert new chromosome into organism organism copies new gene as if it were its own organism reads gene as if it were its own organism produces NEW protein: Regents Biology Remember: we all use the same genetic code! Cutting DNA DNA “scissors” enzymes that cut DNA restriction enzymes used by bacteria to cut up DNA of attacking viruses EcoRI, HindIII, BamHI cut DNA at specific sites enzymes look for specific base sequences GTAACG|AATTCACGCTT GTAACGAATTCACGCTT CATTGCTTAA|GTGCGAA CATTGCTTAAGTGCGAA Regents Biology Restriction enzymes Cut DNA at specific sites leave “sticky ends” restriction enzyme cut site GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA Regents Biology Sticky ends Cut other DNA with same enzymes leave “sticky ends” on both can glue DNA together at “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA Regents Biology gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA Sticky ends help glue genes together cut sites gene you want cut sites TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA sticky ends cut sites isolated gene chromosome want to add gene to AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA DNA ligase joins the strands sticky ends stick together Recombinant DNA molecule chromosome with new gene added TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC Regents Biology CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC How can bacteria read human DNA? Why mix genes together? Gene produces protein in different organism or different individual human insulin gene in bacteria TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC “new” protein from organism ex: human insulin from bacteria aa aa aa aa aa aa aa aa aa aa bacteria Regents Biology human insulin Uses of genetic engineering Genetically modified organisms (GMO) enabling plants to produce new proteins Protect crops from insects: BT corn corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn) Extend growing season: fishberries strawberries with an anti-freezing gene from flounder Improve quality of food: golden rice rice producing vitamin A improves nutritional value Regents Biology Bacteria Bacteria are great! one-celled organisms reproduce by mitosis easy to grow, fast to grow generation every ~20 minutes Regents Biology Bacterial DNA Single circular chromosome only one copy = haploid no nucleus Other DNA = plasmids! bacteria chromosome plasmids Regents Biology There’s more… Plasmids small extra circles of DNA carry extra genes that bacteria can use can be swapped between bacteria bacterial sex!! rapid evolution = antibiotic resistance can be picked up from environment Regents Biology How can plasmids help us? A way to get genes into bacteria easily insert new gene into plasmid insert plasmid into bacteria = vector bacteria now expresses new gene bacteria make new protein gene from other organism cut DNA plasmid Regents Biology recombinant plasmid + vector glue DNA transformed bacteria Grow bacteria…make more gene from other organism recombinant plasmid + vector plasmid grow bacteria harvest (purify) protein Regents Biology transformed bacteria Applications of biotechnology Regents Biology I’m a very special pig! Got any Questions? Regents Biology 2006-2007 Biotechnology Gel Electrophoresis Regents Biology 2006-2007 Many uses of restriction enzymes… Now that we can cut DNA with restriction enzymes… we can cut up DNA from different people… or different organisms… and compare it why? forensics medical diagnostics paternity evolutionary relationships and more… Regents Biology Comparing cut up DNA How do we compare DNA fragments? separate fragments by size How do we separate DNA fragments? run it through a gelatin gel electrophoresis How does a gel work? Regents Biology Gel electrophoresis A method of separating DNA in a gelatin-like material using an electrical field DNA is negatively charged when it’s in an electrical field it moves toward the positive side DNA – Regents Biology “swimming through Jello” + Gel electrophoresis DNA moves in an electrical field… so how does that help you compare DNA fragments? size of DNA fragment affects how far it travels small pieces travel farther large pieces travel slower & lag behind DNA – Regents Biology “swimming through Jello” + Gel Electrophoresis DNA & restriction enzyme longer fragments wells power source gel shorter fragments Regents Biology + completed gel fragments of DNA separate out based on size Running a gel cut DNA with restriction enzymes 1 2 Stain DNA Regents Biology ethidium bromide binds to DNA fluoresces under UV light 3 DNA fingerprint Why is each person’s DNA pattern different? sections of “junk” DNA doesn’t code for proteins made up of repeated patterns CAT, GCC, and others each person may have different number of repeats many sites on our 23 chromosomes with different repeat patterns GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTT Regents CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA Biology DNA patterns for DNA fingerprints Allele 1 cut sites repeats cut sites GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA Cut the DNA GCTTGTAACG GCCTCATCATCATCGCCG GCCTACGCTT CGAACATTGCCG GAGTAGTAGTAGCGGCCG GATGCGAA 1 2 – DNA allele 1 Regents Biology 3 + Differences between people Person 1 cut sites cut sites GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA Person 2: more repeats GCTTGTAACGGCCTCATCATCATCATCATCATCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA 1 2 DNA fingerprint – DNA person 1 person 2 Regents Biology 3 + Uses: Evolutionary relationships Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel fruitfly – DNA + Regents Biology 1 2 3 4 5 1 2 3 4 5 Uses: Medical diagnostic Comparing normal allele to disease allele chromosome with normal allele 1 chromosome with disease-causing allele 2 – DNA Example: test for Huntington’s disease + Regents Biology Uses: Forensics Comparing DNA sample from crime scene with suspects & victim suspects S1 S2 S3 crime scene V sample – DNA Regents Biology + DNA fingerprints Comparing blood samples on defendant’s clothing to determine if it belongs to victim DNA fingerprinting Regents Biology RFLP / electrophoresis use in forensics 1st case successfully using DNA evidence 1987 rape case convicting Tommie Lee Andrews “standard” semen sample from rapist blood sample from suspect “standard” How can you compare DNA from blood & from semen? RBC? “standard” semen sample from rapist blood sample from suspect “standard” Regents Biology Electrophoresis use in forensics Evidence from murder trial Do you think suspect is guilty? blood sample 1 from crime scene blood sample 2 from crime scene blood sample 3 from crime scene “standard” blood sample from suspect OJ Simpson blood sample from victim 1 N Brown blood sample from victim 2 R Goldman Regents Biology “standard” Uses: Paternity Who’s the father? Mom F1 – DNA Regents Biology + F2 child I’m a-glow! Got any Questions? Regents Biology 2006-2007 Using Stem Cells A stem cell is a cell that can continuously divide and differentiate into various tissues. Some stem cells have more potential to differentiate than others. Adults’ bodies have some multipotent cells that can be removed, frozen or cultured, and used for medical treatments. The cells of new embryos have more potential uses. The use of embryos for stem cell research poses ethical problems. An alternative source of embryonic stem cells is through SCNT (somatic cell nuclear Regentstransplant). Biology What are Stem Cells? Stem Cells are extraordinary because: • They can divide and make identical copies of themselves over and over again (Self-Renewal) • Remain Unspecialized with no ‘specific’ function or become . . . . • Specialized (Differentiated) w/ the potential to produce over 200 different types of cells in the body. Regents Biology The Major Types of Stem Cells A. Embryonic Stem Cells • From blastocysts left over from In-Vitro Fertilization in the laboratory • From aborted fetuses B. Adult Stem Cells • Stem cells have been found in the blood, bone marrow, liver, kidney, cornea, dental pulp, umbilical cord, brain, skin, muscle, salivary gland . . . . Regents Biology Regents Biology http://commons.wikimedia.org/wiki/Image:Stem_cells_diagram.png Advantages and Disadvantages to Embryonic and Adult Stem Cells. Embryonic S.C. Adult S.C. “Pluripotent” (can become any cell) “Multipotent” (“can become many but not any”) Less Stable. Capacity for self-renewal is limited. Difficult to isolate in adult tissue. Stable. Can undergo many cell divisions. Easy to obtain but blastocyst is destroyed. Possibility of rejection?? Host rejection minimized Regents Biology Regents Biology http://www.pbs.org/newshour/bb/science/jan-june14/stemcells_01-29.html Reprinted with permission of Do No Harm. Click on image for link to website. http://www.youtube.com/watch?v=7Ql WBnL0zjU Regents Biology Why is Stem Cell Research So Important to All of Us? Stem cells allow us to study how organisms grow and develop over time. Stem cells can replace diseased or damaged cells that can not heal or renew themselves. We can test different substances (drugs and chemicals) on stem cells. We can get a better understanding of our “genetic machinery.” Regents Biology What Human Diseases are Currently Being Treated with Stem Cells? Parkinson’s Disease Leukemia (Bone Marrow Transplants) Skin Grafts resulting from severe burns Stem Cell Therapy has the Potential to: Regenerate tissues/organs Cure diseases like diabetes, multiple sclerosis, etc. Regents Biology Why the Controversy Over Stem cells? Embryonic Stem cells are derived from extra blastocysts that would otherwise be discarded following IVF. Extracting stem cells destroys the developing blastocyst (embryo). -Questions for ConsiderationIs an embryo a person? Is it morally acceptable to use embryos for research? When do we become “human beings?” Regents Biology Key Concept Questions How are transgenic organisms useful to human beings? Genetic engineering has spurred the growth of biotechnology, a new industry that is changing the way we interact with the living world How are cloning and stem cell research related? Cloning can produce organisms that are genetically identical to preexisting individuals. Stem cells can be used to Regents Biologynew tissues. grow