Transcript t - DTU CBS
Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go CELL RNA Why? RNA How? gene mRNA gene specific DNA probes labeled target Microarrays - The Technologies Stanford-type Microarrays High-density Stanford-type Microarrays Stanford-type Microarrays Coating glass slides Deposition of probes Post-processing Hybridization Spotting - Mechanical deposition of probes 16-pin microarrayer Microarrayer Stanford microarrays CONTROL SAMPLE mRNA mRNA cDNA cDNA Cy5-cDNA Cy3-cDNA Affymetrix GeneChip® oligonucleotide array • 11 to 20 oligonucleotide probes for each gene • On-chip synthesis of 25 mers • ~20,000 genes per chip • good quality data • 280-500 K features to play with Photolithography in situ synthesis T A T T T A A T Mask #2 Mask #1 T A A T T T A T A AA A Spacers bound to surface with photolabile protection groups Sample Preparation - Eberwine SAMPLE 42 C 2h + Reverse Transcriptase 16 C 2h + RNase H + Polymerase 37 C 6h RNA ssDNA T7 70 C 10 min T7 pol clean up dsDNA dsDNA + Biotin-labeled nucleotides aRNA Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-SAPE IgG biotinylated anti-anti IgG The Affymetrix GeneChip® A gene is represented like this: PM MM - Perfect Match (PM) - MisMatch (MM) PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT NimbleGen • 385,000 to 2.1 mill features • Long probes (up to 70 nt) • Service: -labelling -scanning -image analysis Photolithography - Micromirrors Analysis of Data Normalization: Linear or non-linear Is it worth it? Number of known positives Known positives versus the total number of significantly affected genes at 5 different cutoffs in the TnrA experiment Qspline normalization Linear normalization Number of significantly affected genes Analysis of Data Normalization: Linear or non-linear Statistical test: student’s t-test ANalysis Of VAriance (ANOVA) Analysis: Principal Component Analysis (PCA) Clustering and visualization Tiling arrays Tiling arrays are used for determation of genes, ncRNAs, TF-binding sites, ... Regulatory T Cells and Allergy Hanne Jarmer (CBS) Type I Hypersensitivity A normal reaction against parasites Typical allergens: - pollen - penicillin - nuts - milk - bee venom - mold spores Early Last Century Poul Portier and Charles Richet observed: Portuguese Man of War “Hmm..., maybe we can make a vaccine?” Early last century Early Last Century 1. time: No reaction 2. time: Got sick died Immediate Hypersensitivity anaphylaxis Richet got the Nobel Prize The Mechanism The Regulation Several factors are important: - genetics - presentation (concentration/mode) - TH1, TH2 and TReg The Regulation The Naive T cell will differentiate into different subsets induced by different cytokines Naive T cell Cytokines TC TH1 TH2 TReg The Regulation Naive T cell IL-12 IL-10 ? IL-4 TH1 TH2 TReg CD4+ T cells - The normal state - Keeping the balance TH1 TReg TH2 The allergic state - Out of balance TReg TH1 TH2 Three types of TReg cells CD25 TReg1 TReg2 IL-10 TGF- TReg3 CD25 = IL-2 receptor (IL2RA) CD25+ TReg cells - Low proliferative capacity - Immunoregulatory properties - T cell homeostasis - Prevents autoimmunity - Antigen specific, cell-cell adhesion - Induction of tolerance ... but how? Potential use in Immuno Specific Therapy (SIT) - graft tolerance ... or the other way around ... in vaccines or cancer treatment Microarray Project The goal: Investigate the mechanism find cure for allergy or an effective SIT The plan: Find the responsible genes by the use of carefully designed microarray experiments The Microarray Experiments Blood from 5 normal and 5 allergic patients normal normal allergic CD4+CD25+ CD4+CD25+ normal allergic CD4+ CD4+ 20 microarrays allergic The Microarray Experiments 20 microarrays 2-way ANOVA 2 Normal Allergic CD4+CD25+ CD4+CD25+ 1 1 Normal Allergic CD4+ CD4+ 2 2-way ANOVA The Regulatory T cell signal Natural Treg cells Nature Immunology 6, 345 - 352 (2005) Naturally arising Foxp3-expressing CD25+CD4+ regulatory T cells in immunological tolerance to self and non-self by Shimon Sakaguch Maybe ... CTLA-4 TReg X (TCR B7 APC MHC-II) Allergic TReg: Less X Fewer active TReg cells No tolerance Thanks to Liu Anting, PhD from ALK ALK-abello Kristine Dahlin and Thomas Jensen