Marker Assisted Selection in Disease Resistance

Download Report

Transcript Marker Assisted Selection in Disease Resistance

Signal Transduction
Pathways
Signal Transduction Pathways
• link cellular responses to plant hormonal signals
environmental stimuli
• Binding of a hormone to a membrane receptor may
stimulate production of second messengers
• The activation of protein kinases, which in turn
activate other proteins is a common component of
signal transduction in plants
• Hormones may enter the cell to bind with a
receptor, and environmental stimuli can also trigger
signal-transduction pathways
Signal Transduction Components
Stimulus
Hormones, physical environment, pathogens
Receptor
On the plasmamembrane, or internal
Secondary messengers
Ca2+, G-proteins, Inositol Phosphate
Effector molecules
Protein kinases or phosphatases
Transcription factors
Response
Stomatal closure
Change in growth direction
Signal transduction
Simplified model
STIMULUS
Ca2+
Plasma
membrane
R
Ca2+
Phos
Kin
Nuclear
membrane
R
TF
DNA
Light in Plants
We see visible light (350-700 nm)
Plants sense Ultra violet (280) to Infrared (800)
Examples
Seed germination - inhibited by light
Stem elongation- inhibited by light
Shade avoidance- mediated by far-red light
There are probably 4 photoreceptors in plants
We will deal with the best understood;
PHYTOCHROMES
The structure of Phytochrome
A dimer of a 1200 amino acid protein with several domains and 2
molecules of a chromophore.
Chromophore
660 nm
730 nm
Pr
Pfr
Binds to membrane
Signal Transduction of Phytochrome
Membrane
Pfr
Ga
G protein a subunit
Pr
Guanylate cyclase
cGMP
Ca2+/CaM Calmodulin
CAB, PS II
ATPase
Rubisco
FNR
PS I
Cyt b/f
Chloroplast biogenesis
Cyclic
guanidine
monophosphate
CHS
Anthocyanin synthesis
Light-Regulated Elements (LREs)
e.g. the promotor of chalcone synthase-first enzyme in
anthocyanin synthesis
Promoter has 4 sequence motifs which participate in light regulation.
If unit 1 is placed upstream of any transgene, it becomes light regulated.
-252
-230
IV
III
-159
II
-131
+1
I
Unit 1
5’-CCTTATTCCACGTGGCCATCCGGTGGTGGCCGTCCCTCCAACCTAACCTCCCTTG-3’
Transcription
Factors
bZIP
Myb
Light-Regulated Elements (LREs)
 There are at least 100 light responsive genes (e.g.
photosynthesis)
 There are many cis-acting, light responsive regulatory
elements
 7 or 8 types have been identified of which the two for CHS
are examples
 No light regulated gene has just 1.
 Different elements in different combinations and contexts
control the level of transcription
 Trans-acting elements and post-transcriptional modifications
are also involved.
Plant growth regulators and their impact
on plant development
Hormone
Response
(not a complete list)
Auxin
Abscission suppression; apical dominance; cell elongation;
fruit ripening; tropism; xylem differentiation
Cytokinin
Bud activation; cell division; fruit and embryo development;
prevents leaf senescence
Gibberellin
Stem elongation; pollen tube growth; dormancy breaking
Abscisic Acid
Initiation of dormancy; response to stress; stomatal closure
Ethylene
Fruit ripening and abscission; initiation of root hairs;
wounding responses
Abscisic Acid (ABA) responsive genes
ABA is involved in two distinct processes
1/ Control of seed development and germination
2/ Stress responses of the mature plant
DROUGHT
IN SALINITY
A suite of stress response genes are turned on
COLD
The signal transduction pathway
is still poorly understood but
certain common regulatory
elements have been found in the
promoters of ABA responsive
genes.
CH3
CH3
CH3
OH
O
CH3
COOH
Promoter studies of ABA responsive elements in Barley
Section of the upstream region of a barley ABA responsive gene
CCGGCTGCCCGCCACGTACACGCCAAGCACCCGGTGCCATTGCCACCGG
-104
-56
(Shen and Ho 1997)
Minimal
promoter
Reporter
gene (GUS)
ABA responsiveness
GUS activity in the presence of ABA
related to no ABA
1x
38x
24x
55x
87x
ABA responsive elements
GCCACGTACANNNNNNNNNNNNNNNNNNNNTGCCACCGG--------
ACGCGTCCTCCCTACGTGGC-----------------------------------
Plant Disease Resistance
Importance of pests and pathogens
Complete v.s. partial resistance
Gene for gene theory
Cloned resistance genes
A model of Xa21, blight resistance gene
The arms race explained
Complete and Partial Resistance
There are two fundamentally different
mechanisms of disease resistance.
Complete resistance
Partial Resistance
vertical resistance
Highly specific (race
specific)
Involves evolutionary
genetic interaction (arms
race)
between host and one
species of pathogen.
QUALITATIVE
horizontal resistance
Not specific- confers
resistance to a range of
pathogens
QUANTITATIVE
Complete and Partial Resistance
There are two fundamentally different
mechanisms of disease resistance.
Complete resistance
Partial resistance
Frequency %
Frequency %
40
30
25
30
20
20
15
10
10
5
0
0
1
2
3
4
5
6
7
8
Disease severity class
9
10
1
2
3
4
5
6
7
8
Disease severity class
9
10
Gene-for-Gene theory of Complete
Resistance
Pathogen has
virulence (a)
and avirulence
(A) genes
A
a
Plant has resistance gene
RR
rr
If the pathogen has an Avirulence gene and the host a
Resistance gene, then there is no infection
Gene-for-Gene theory of Complete
Resistance
The Avirulence gene codes for an Elicitor molecule or
protein controlling the synthesis of an elicitor.
The Resistance gene codes for a receptor molecule which
‘recognises’ the Elicitor.
A plant with the Resistance gene can detect the
pathogen with the Avirulence gene.
Once the pathogen has been detected, the plant
responds to destroy the pathogen.
Both the Resistance gene and the Avirulence gene are
dominant
Gene-for-Gene theory of Complete
Resistance
What is an elicitor?
It is a molecule which induces any plant defence response.
It can be a polypeptide coded for by the pathogen avirulence gene, a
cell wall breakdown product or low-molecular weight metabolites.
Not all elicitors are associated with gene-for-gene interactions.
What do the Avirulence genes (avr genes) code for?
They are very diverse!
In bacteria, they seem to code for cytoplasmic enzymes involved in
the synthesis of secreted elicitor. In fungi, some code for secreted
proteins, some for fungal toxins.
ELICITORS
Elicitors are proteins made by the pathogen avirulence
genes, or the products of those proteins
Elicitors of Viruses
Coat proteins, replicases, transport proteins
Elicitors of Bacteria
40 cloned, 18-100 kDa in size
Elicitors of Fungi
Several now cloned- diverse and many unknown function
Elicitors of Nematodes
Unknown number and function
Gene-for-Gene theory of Complete
Resistance
What does a resistance gene code for?
The receptor for the specific elicitor associated with the
interacting avr gene
Protein structure of
cloned resistance genes N
C
Pto
tomato; bacterial resistance
N
C
Xa21
rice; bacterial resistance
N
C
Hs1 sugar beet; nematode res.
Cf9, Cf2 tomato; fungal resistance
N
C
L6 flax; fungal resistance
C
RPS2, RMP1 Arabidopsis; bac. res.
N tomato; viral resistance
Prf tomato; bacterial resitance
N
Membrane anchor site
Transmembrane domain
Serine/threonine protein
kinase domain
Conserved motif
Signal peptide
Leucine zipper domain
Leucine-rich repeat
DNA binding site
Model for the action of Xa21
(rice blight resistance gene)
Leucine-rich receptor
Transmembrane domain
Elicitor
Cell Wall
Membrane
Kinase
Signal transduction
([Ca2+], gene expression)
Plant Cell
The arms race explained
An avirulence genes
mutates so that it’s
product is no longer
recognised by the host
resistance gene.
The host resistance gene
mutates to a version
which can detect the
elicitor produced by the
new virulence gene.
It therefore
becomes a
virulence gene
relative to the host,
and the pathogen
can infect.
Hypersensitive Reaction/ Programmed
Cell Death
In response to signals, evidence suggests that
infected cells produce large quantities of extracellular superoxide and hydrogen peroxide which may
1. damage the pathogen
2. strengthen the cell walls
Oxidative
3. trigger/cause host cell death
Burst
Evidence is accumulating that host cell also undergo
changes in gene expression which lead to cell death
Programmed Cell Death
Systemic Acquired Resistance
Inducer inoculation
3 days to months,
then inoculate
SAR- long-term resistance to a range of
pathogens throughout plant caused by
inoculation with inducer inoculum
Local
acquired
resistance
Systemic
acquired
resistance
Marker Assisted Selection
Targets for crop improvements
Genetics of improvement
Molecular mapping
Mapping a qualitative trait
Marker assisted selection for aroma in rice
Marker assisted selection for multiple resistant genes
Mapping quantitative traits
QTLs and marker assisted selection
Targets for Improvement
Targets for improvement in rice production fall into three
categories
Biotic constraints- (pests and diseases)
Weeds, Fungi (e.g. Blast), Bacteria (e.g. Blight), Viruses (e.g.
Rice yellow mottle virus), Insects (e.g. Brown plant hopper),
Nematodes (e.g. Cyst-knot nematode)
Abiotic constraints (adverse physical environment)
Drought, Nutrient availability, Salinity Cold, Flooding
Yield and quality
Plant morphology, Photosynthetic efficiency, Nitrogen
fixation, Carbon partitioning, Aroma
Genetics of improvement
Biotic constraintsQualitative (complete resistance)
Quantitative (partial resistance)
Abiotic constraintsQuantitative (mostly)
Yield and qualityQualitative (aroma, partitioning)
Quantitative (morphology, partitioning)
Requires genetic engineering (photosynthesis, n.
fixation)
Marker Assisted Selection
Useful when the gene(s) of interest is difficult to
select for.
1. Recessive Genes
2. Multiple Genes for Disease Resistance
3. Quantitative traits
4. Large genotype x environment interaction
Molecular Maps
Molecular markers (especially RFLPs and SSRs) can
be used to produce genetic maps because they
represent an almost unlimited number of alleles
that can be followed in progeny of crosses.
Chromosomes with
morphological
marker alleles
Chromosomes with molecular
marker alleles
RFLP1b
RFLP2b
SSR1b
T
t
r
R
or
RFLP1a
RFLP2a
SSR1a
RFLP3b
RFLP3a
SSR2b
SSR2a
RFLP4b
RFLP4a
1
2
3
4
5
6
51 cM
54 cM
54 cM
51 cM
7
8
9
10
11
12
48 cM
Molecular
map of
cross
between
rice
varieties
Azucena
and Bala.
Mapping
population
is an F6
MOLECULAR MAPS CAN BE USED TO LOCATE GENES
FOR USEFUL TRAITS (CHARACTERISTICS)
To locate useful genes on chromosomes by
linkage mapping, you need
1. A large mapping population (100 + individuals) derived from
parental lines which differ in the characteristic or trait you
are interested in.
2. Genotype the members of the population using molecular
markers which are polymorphic between the parents (e.g.
RFLPs, AFLPs, RAPDs)
3. Phenotype the members of the population for the trait
making sure you asses each individual as accurately as
possible
Bala
F1 (self)
1 Individual
F2
F2
F2
F2
F2 (self)
205 individuals
F3
F3
F3
F3
F3 (self)
205 individuals
F4
F4
F4
F4
F4 (self)
205 individuals
F5
F5
F5
F5
F5 (self)
205 individuals
Single Seed Decent
Azucena x
Seed multiplication
F6
F6
F6
F6
F6
205 families
What is an
F6 mapping
population?
Making A Linkage Map
R642
RZ141
G320
G44
RG2
C189
G1465
Rice chromosome 11
Genotype
G320 RG2 C189
A
A
A
A
A
B
A
B
A
A
B
B
B
A
A
B
B
A
B
A
B
B
B
B
Total
No. of
Individuals
47
8
5
15
19
24
3
42
.
163
Recombinants between G320 and RG2 = 5 + 15 + 19 + 3 = 42 = 26%
Recombinants between RG2 and C189 = 8 + 5 + 24 + 3 = 40 = 25%
Recombinants between G320 and C189 = 8 + 15 + 19 + 24 = 66 = 40%
Making a Linkage Map
A
A
A
G320 RG2
C189
A
A
A
B
B
A
Frequency of Genotype
B
B
A
47
8
5
15
19
24
3
42
Mapping a Qualitative Trait
e.g. disease resistance
For a complete resistance gene, one parent is resistant, the
other is susceptible
The individuals in the segregating population are either
resistant or susceptible.
Segregation of disease resistance in population
% of Individuals
60
50
40
30
20
10
0
0
1
2 3 4 5
6 7
Disease Severity Class
8
9
% of Individuals Not
Infected
Disease resistant individuals
for each genotype
0%
0%
80%
87%
37%
100%
0%
100%
Mapping a
Qualitative Trait
11
R642
RZ141
G320
G44
RG2
100
C189
80
60
A
B
40
20
G1465
Blast resistance gene
0
Parents
G320
RG2
Genotype at RFLP
C189
Marker Assisted Selection for Aroma in Rice
The variety Azucena is aromatic (i.e. it smells pleasant and it’s
seeds smell and taste pleasant)
Therefore Azucena rice fetches a higher price
The aroma gene is recessive. Therefore, it can’t be followed in
backcross breeding.
The gene for aroma has been mapped to chromosome 8
Kalinga III is a popular variety in Eastern India but it is not
aromatic.
The aroma gene of Azucena has been crossed into Kalinga III
by selection for RFLPs linked to the aroma gene
Azucena
Kalinga III
F1
Selected BC1
Non-selected BC1
Azucena
Kalinga III
F1
Selected BC1
Non-selected BC1
Marker Assisted Selection
Using
molecular
markers
as
selection criteria rather than the
gene you want to transfer
Chromosome 8
G1073
R2676
Aroma gene flanked by G1073 and R2676
Marker Assisted Selection in Disease Resistance
Resistance genes can be selected for by screening with the disease.
So, conventional breeding can produce resistant varieties.
But, resistance genes break-down. The disease organism mutates to
overcome them (in 2-3 years).
If there were several resistance genes, the disease organism would
take very much longer to overcome all resistance genes (in fact it is
virtually impossible).
But, you can’t select for say 3 resistance genes conventionally- you
can’t tell the difference between 1 gene and 2 or 3 by phenotype.
But if you select for markers linked to the resistance genes, you can
introduce multiple resistance genes.
Marker Assisted Selection in Disease Resistance
Donor1
Donor 2
Donor 3
Selectable markers
Elite variety
Multiple crosses
followed by
backcrossing
with selection for
markers at every
stage
Elite variety with
multiple resistance
genes
Mapping a Quantitative Trait
e.g. rooting depth
11
30
10
0
R642
RZ141
G320
20
200 250 300 350 400 450 500 550 600 650
Max. Root Length Class (mm)
G44
RG2
Max. Root Length (mm)
% of Individuals
40
C189
600
550
500
450
400
350
300
A
G1465
B
Parents
G320
RG2
Genotype at RFLP
C189
Root length gene
Mapping a Quantitative Trait
e.g. rooting depth
30
20
Difference between
parents is 360 mm
10
0
Max. Root Length (mm)
% of Individuals
40
200 250 300 350 400 450 500 550 600 650
Max. Root Length Class (mm)
600
550
500
450
400
350
300
Difference between
genotype classes at
RG2 is 50 mm
A
B
Parents
G320
RG2
Genotype at RFLP
C189
This locus accounts
for 16% of the
difference
Quantitative trait loci (QTLs) and Marker Assisted Selection
QTLs (the location of a gene contributing to a quantitatively
variable trait) are difficult to select for conventionally;
it is very difficult to identify individuals with the QTL from those
without because its effect is small.
Marker assisted selection can be used once markers at the QTL
have been found.
Multiple QTLs can be combined for greater effect.
1
2
3
4
5
6
51 cM
54 cM
54 cM
51 cM
7
8
9
10
11
12
48 cM
Azucena QTLs targeted in the Marker Assisted Selection to
improve the root system of Kallinga III
Genetic Engineering
Genetic transformations
Agrobacterium transformations
Direct transfer methods for transformation
Transformation cassettes
From transformed cells to plants
The use of transformed plants in research
Mutants
Transposon
Transposon and T-DNA tagging
Genetic Engineering of PlantsAgrobacterium transformationThe bacteria Agrobacterium tumefaciens causes galls or tumors on plants
Genomic DNA
Ti Plasmid
(tumor inducing)
T-DNA
(transfer)
Restrict and ligate together
Foreign DNA
T-DNA
(transfer)
Re-introduce recombinant DNA
Agrobacterium transformation 2
Infect plant with
recombinant agrobacterium
Grow up transformed
plants from single
cells
Whole T-DNA transferred
randomly into plant
chromosome
“GENETIC ENGINEERING” without
AGROBACTERIUM
All involve getting DNA directly across the plasma membrane
Shock of protoplasts
Micro-injection
Biolistics
Transformation constructs or cassettes
•Genes of interest
•Promoter
•Selectable (marker) gene
Gene of interest
T-DNA
Promoter
e.g. Cauliflower
Mosaic Virus 35S
RNA gene
promoter
(CAM 35S)
T-DNA
Selectable marker-gene
e.g. antibiotic resistance
or herbicide resistance
Allows transgenic cells to be
selected from
non-transgenic
From transformed cells to plants
Plant cells are grown as a callus of
undifferentiated cells on agar
plates
transformation
After transformation, cells grown
on selective media (e.g. containing
antibiotic)
selection
Untransformed cells die
Transfer to
tube with
hormones
Cells containing transgenes grow
into plantlets
Transgenic plants as a research tool for non-genetic studies
e.g. aequorin transformed plants to study calcium’s role as secondary messenger
The aequorin gene from a luminescent jellyfish produces a protein aequorin.
When combined with a small chromophore, coelentrazine, the complex gives
off blue light at a rate dependent on [Ca2+].
When transformed in to tobacco, this
gene can be used to study the role of
[Ca2+] in signal transduction
Tobacco
Transient increase in
luminescence of
tobacco plant
challenged with
fungal elicitor.
Ca2+ involved in
pathogen recognition
Luminescence
Aequorin
Time
Knight et al. 1991
Transgenic plants to identifying gene function through novel
expression eg -3fatty acid desaturase from Arabidopsis in tobacco
•-3fatty acid desaturase converts 16:2 and 18:2 dienoic fatty acids to 16:3 and
18:3 trienoic acids.
•A greater degree of fatty acid unsaturation (especially in the chloroplast) was
thought to confer greater resistance to cold in plants.
Growth after cold
shock relative to
control
•Transformation of tobacco (which lacks the enzyme) with the enzyme from
Arabidopsis, increases fatty acid unsaturation.
Untransformed
Transformed
-3fatty acid desaturase
transformation confers cold
tolerance, confirming that
unsaturation is important.
Transgenic plants to identify gene function through over expression
e.g. over-expression of antioxidant proteins
The Halliwell-Asada pathway
O2.-
Superoxide Dismutase
H2O2
Ascorbate peroxidase
H2O
MDHA
Ascorbate
DHA
Dehydroascorbate
reductase
GSSG
GSH
NADP+
Glutathione reductase
NADPH
The Halliwell-Asada
pathway is important in
detoxifying reactive oxygen
intermediates. These are
produced naturally by the
electron-transport chains of
mitochondria and especially
chloroplasts. Most stresses
cause increases in
superoxide or hydrogen
peroxide production.
Transgenic experiments
have investigated the
importance of these
enzymes in stress
resistance.
Transgenic plants to identify gene function through over
expression
e.g. over-expression of antioxidant proteins
Gene Construct
Host
Superoxide Dismutase
Chloroplastic
Tobacco
Mitochondrial
Cytosolic
Tomato
Potato
Alfalfa
Tobacco
Alfalfa
Potato
Plant Phenotype
No protection from MV or O3
Reduced MV damage and photoinhibition
Reduced MV damage by no protection of photoinhibition
No protection from photoinhibition
Reduced MV damage
Reduced aciflurofen, freezing and drought damage
Reduced MV damage in the dark
Reduced freezing and drought damage
Reduced MV damage
Ascorbate Peroxidase
Cytosoloc
Tobacco
Chloroplastic
Tobacco
Reduced MV damage and photoinhibition
Reduced MV damage and photoinhibition
Glutathione Reductase
E. coli in c.plast Tobacco
Poplar
E. coli in cytosol Tobacco
Reduced MV and SO2 damage, not O3
Reduced photoinhibition
Reduced MV damage
Pea
Tobacco
Reduced O3 damage, variable with MV
MV = methyl viologen = paraquat
Allen et al. 1997
Transgenic Plants to identifying gene function through gene
repression
e.g. polygalacturinase and fruit ripening in tomato
•Polygalacturinase breaks down cell walls.
•It’s expression is considerably enhanced in ripening fruit (it makes the fruit soft).
•Transformation of tomatoes with the anti-sense version (the gene in the opposite
direction), reduces the expression of polygalacturinase.
Sense and anti-sense
mRNAs hybridise in
the cytoplasm and
cause large
Anti-sense mRNA
reductions in
expression
Sense mRNA
Polygalacturinase
activity
Result- tomatoes don’t soften so quickly- FLAVR SAVR TOMATO
Untransformed
Transformed
Time
Transgenic plants to study of promoter function through reporter
gene studies
e.g. ABA responsive promoter from barley
Section of the upstream region of a barley ABA responsive gene
CCGGCTGCCCGCCACGTACACGCCAAGCACCCGGTGCCATTGCCACCGG
-104
-56
(Shen and Ho 1997)
Minimal
promoter
Reporter
gene (GUS)
ABA responsiveness
GUS activity in the presence of ABA related to no ABA
1x
38x
24x
55x
87x
Mutants and Plant Genetics
DNA damage- X and Gamma rays, sodium azide (NaN3)
Transposons and T-DNA tagging
The Ac transposable element of maize
11-bp inverted
repeats
Cis-determinants
for excision
Exons of
transposase gene
Introns
A transposon can move at random throughout a plant genome. It is
cut out of its site and reinserted into another site by the action of
an endonuclease and the transposase.
Insertion into a functional gene causes mutation.
Transposons and T-DNA tagging
Transposons have only been found in a few plants (e.g. Maize,
Antirrhium). But, they can be introduced by transformation. The Ac
transposon has been introduced to tobacco, Arabidopsis, potato,
tomato, bean and rice.
Mutations using transposons or T-DNA (both of which insert
randomly into nuclear DNA) are produced by transformation
methods described earlier. Large numbers of plants are screened for
an observable phenotype (e.g. lack of response to light).
Screen
Identify mutated
gene
Transposons and T-DNA tagging
The gene into which the insert has occurred can be recovered by PCR
Mutated ORF
Insertion (Transpososn or T-DNA)
Restrict
Ligate
PCR amplify using primers
homologous to and facing out of
insert