Transcript Heritable Disorders of Connective Tissue: Research & Repository

Research Repository for Heritable Disorders
University of Washington - Department Pathology
Peter Byers, MD
Ulrike Schwarze, MD
Melanie Pepin, MS, CGC
Dru Leistritz, MS
The Research Repository is housed alongside the Collagen Diagnostic
Laboratory, a certified clinical laboratory that provides testing and consultation for
patients with suspected connective tissue disorders.
Having DNA, tissues and clinical information from individuals with the disease –
essential to our research work.
Research Repository for Heritable Disorders
RECRUITMENT FOR CLINICAL RESEARCH STUDIES
1. Diagnostic Testing Samples – Repository Consent is optional.
2. Internet recruitment via EDNF or EDSCares.
3. Recruitment at EDS meetings – e.g. currently enrolling for
Pregnancy in EDS type IV study
Each study is approved by the University of Washington Human Subjects
Committee (IRB).
Research Repository for Heritable Disorders of Bone, Blood Vessels
and Skin
1.
Gene Identification for a CLINICAL DIAGNOSIS – Periodontal EDS
2.
Clinical Test Development after Gene Identification – Classical EDS and
Hypermobility EDS
3.
Understanding Disease Process – Genotype-Phenotype Relationship –
Vascular EDS
4.
Natural History Study: Evidence-based Clinical Care – Vascular EDS
Pregnancy Study
Research Repository for Heritable Disorders of Bone, Blood Vessels
and Skin
1.
Gene Identification for a CLINICAL DIAGNOSIS – Periodontal EDS
2.
Clinical Test Development after Gene Identification – Classical EDS and
Hypermobility EDS
3.
Understanding Disease Process – Genotype-Phenotype Relationship –
Vascular EDS
4.
Natural History Study: Evidence-based Clinical Care – Vascular EDS
Pregnancy Study
EDS type VIII – Distinct Clinical Phenotype
Mutation Unknown
Joint Hypermobility
& Stretchy Skin
Tissue fragility following repeated trauma to
an injury-prone area.
Bleeding tendency & delayed wound
healing.
Severe gingival recession (16yo)
Mataix et al B J Dermatology 2008
1. Gene Identification for a CLINICAL DIAGNOSIS of Periodontal EDS
RR is pairing with by Dr. Debbie Nickerson in UW Genome Sciences
department on an NIH-funded project to attempt to find disease yetundiscovered genes for rare disorders.
Current Project: Whole Exome Sequencing of DNA in families with EDS type
VIII, the periodontal form of EDS.
DNA Sequence
Exons
translate to
PROTEINS
GGTGACCGTGGTGAGACCGGCCCC
Control
GGTGACCGTGGTGAGACCAGCCCC
G1040S
GGC>AGC
EDS type VIII – Exome Sequencing Strategy
EXOME – 2% of genome but 85%
of mutations. 20,000 genes.
Thousands of variants in
sequence.
Those studied must have the same
clinical diagnosis.
Choose:
1. Multiple members of one family
2. Several unrelated individuals
with identical phenotype
2009 First Whole exome sequencing
Research Repository for Heritable Disorders of Bone, Blood Vessels
and Skin
1.
Gene Identification for a CLINICAL DIAGNOSIS – Periodontal EDS
2.
Clinical Test Development after Gene Identification – Classical EDS and
Hypermobility EDS
3.
Understanding Disease Process – Genotype-Phenotype Relationship –
Vascular EDS
4.
Natural History Study: Evidence-based Clinical Care – Vascular EDS
Pregnancy Study
Causative Genes: Classical EDS (EDS type I and II)
Alterations in type V collagen
genes: COL5A1 and COL5A2
Tenascin-X deficiency
- XB gene
Other - unknown
40-50%
5/151 EDS cases
Bristow 2001
Tenascin X deficiency: Classical EDS-like Syndrome
•
Schalkwijk et al., 2001 reported the 5 (of 151 screened) patients with an
EDS syndrome with deficiency of Tenascin X protein– an extracellular matrix
protein resulting from recessive mutations in the encoding XB gene.
– hypermobile joints
– hyperextensible skin
– easy bruising
– slow wound healing, but normal scar formation
– autosomal recessive
“This finding indicates that factors other than the collagens or collagen-processing enzymes can cause
the syndrome and suggests a central role for tenascin-X in maintaining the integrity of collagenous
matrix. (N Engl J Med 2001;345:1167-75.)”
XB Mutations absent
Tenascin X
Tenascin X
1. Regulates Fibril spacing
2. Associates with other matrix
proteins to make this happen
Tenascin X heterozygosity: What is the role of TNX in Hypermobility
EDS?
Zweers 2003 Test obligate relatives id’d
9/23 obligates with significant joint
Hypermobility. Puzzling finding was that
this was most often found in females.
Zweers 2004 Measured TNX in 80
unrelated hypermobility EDS patients and
found 5-10% with very low levels.
Heterozygous TNX mutation found in 2.
Consequence of the TNX gene sequencing
Sequencing of gene that encodes TNX protein already complete
Setting up a systematic way to sequence over 50 exons at one time
Offer as testing to classical EDS without wide gaping scars
Consider a pilot test of hypermobile EDS to determine test sensitivity
Research Repository for Heritable Disorders of Bone, Blood Vessels
and Skin
1.
Gene Identification for a CLINICAL DIAGNOSIS – Periodontal EDS
2.
Clinical Test Development after Gene Identification – Classical EDS and
Hypermobility EDS
3.
Understanding Disease Process – Genotype-Phenotype Relationship –
Vascular EDS
4.
Natural History Study: Evidence-based Clinical Care – Vascular EDS
Pregnancy Study
Does the Mutation Type determine clinical outcome ? Is there a
Genotype/Phenotype Correlation?
COL3A1 Mutation Types
Reduction in type III collagen – “null”
Alteration in type III collagen structure
Understanding Disease Process – COL3A1 Mutations –
Genotype/Phenotype Correlation
The EDS IV natural history study in 2000 did not find a significant
difference in complications when comparing families with different
mutations (Pepin et al 2000) n=135 No null mutations
Null (nonsense)
n=21
Missense
N=400
Dru Leistritz is leading a study in the RR to review clinical data of consented
“null” families to compare them with previously reported families.
Data will be presented at the November ASHG meeting 2010.
Preliminary data confirms significant difference in age of complications and
age of ascertainment in null families. (e.g age of first complication 24 v 38)
Research Repository for Heritable Disorders of Bone, Blood Vessels
and Skin
1.
Gene Identification for a CLINICAL DIAGNOSIS – Periodontal EDS
2.
Clinical Test Development after Gene Identification – Classical EDS and
Hypermobility EDS
3.
Understanding Disease Process – Genotype-Phenotype Relationship –
Vascular EDS
4.
Natural History Study: Evidence-based Clinical Care – Vascular EDS
Pregnancy Study
•Natural History Study: Contribution to evidence-based Clinical Care
EDS type IV – Pregnancy Study
Enrollment is Open
Women with EDS type IV who have undertaken pregnancies are recruited
and interviewed (or records reviewed) to detail successes and problems
encountered.
Study is being done in collaboration with UWMC MFM physician, Dr.
Suzanne Peterson
Primary Procedure: Phone Interview and Record Review
Goal: Establish evidence-based pregnancy care guidelines
Evaluate the factors at play in decision-making about undertaking a
pregnancy.
Research Repository for Heritable Disorders of Bone, Blood Vessels and Skin
Financial Support
Donations to UW Collagen Research Laboratory (private donations
from families, friends to UW (Byers))
2009 Freudman Fund - family foundation to support research in
EDS (basic science research and clinical research) and related
connective tissue disorders
“ because of the interest and generosity of patients and families with EDS”
Tenascin X deficiency: Classical EDS-like Syndrome
•
Schalkwijk et al., 2001 reported the 5 (of 151 screened) patients with an
EDS syndrome with deficiency of Tenascin X protein– an extracellular matrix
protein resulting from recessive mutations in the encoding XB gene.
– hypermobile joints
– hyperextensible skin
– easy bruising
– slow wound healing, but normal scar formation
– autosomal recessive
“This finding indicates that factors other than the collagens or collagen-processing enzymes can cause
the syndrome and suggests a central role for tenascin-X in maintaining the integrity of collagenous
matrix. (N Engl J Med 2001;345:1167-75.)”