Transcript DNA

Do Now
When you hear “DNA”, what are some
thoughts that come to your mind?
Where is DNA found?
• What organelle is
known as the “control
center” of the cell?
• What structures are
found in the nucleus?
• Chromosome contain
segments called
_________ that code for
traits.
• Genes are made up of
__________.
The Structure of DNA
• DNA = Deoxyribonucleic acid
• 3 Components of DNA:
 Sugar = Deoxyribose
 Phosphates
 Nitrogenous bases
DNA Looks Like A Ladder
• Similar to a ladder:
– Sugar + Phosphate = Sides of a Ladder,
“Backbone”
– Bases = Rungs of a Ladder
The Nitrogenous Bases
2 different
categories of
bases:
– Pyrimidines
– Purines
Pyrimidines
• Has 1 Ring
• Thymine (T)
• Cytosine (C)
Purines
• Have 2 Rings
• Adenine (A)
• Guanine (G)
Base Pairing
• In order to form the rungs of
the ladder, the bases need to be
paired
• A pyrimidine and a purine are
paired together
– Cytosine (C) + Guanine (G)
– Thymine (T) + Adenine (A)
• Hydrogen bonds form between
the pairs and hold them
together
Bases: So What?
• Different sequences of bases code for
different genes/traits.
• Each gene has its own unique sequence of
letters/bases
• Each gene codes for a protein that has its own
unique function in a cell.
How can 4 letters (A,T,C,G) code for all of
our different genes?
• Think of the 26 letters in an alphabet
• Letters can be combined in endless different
ways to form an endless amount words
• In the same way, the 4 bases can be combined
in endless different ways to form an endless
amount of different sequences, resulting in
different genes
Double Helix
• The DNA ladder is actually twisted (coiled)!
Double Helix
• It looks like a spiral staircase!
Why Do You Think DNA Is Coiled?
Double Helix
• Double helix consists of
2 strands
• Each strand consists of…
– a sugar-phosphate
backbone + a sequence
of nitrogenous bases
• The two strands
complement each other
Practice
• Write the sequence that complements the
following strand:
AATCGGGTACGTAGGTCGTAGCT
Base Pairing
Why do you think a purine
is paired with a
pyrimidine?
Answer
• The difference in the number of rings of
purines & pyrimidines is important
• If 2 purines (which each has 2 rings) paired
together, it would be too wide to fit within the
backbone
• If 2 pyrimidines (which each has 1 ring) paired
together, it would be too narrow to fit within
the backbone
Hands-On Activity:
Building a model of DNA