Transcript Figure 2 - York College of Pennsylvania

EFFECTS OF THE TESTICULAR ENVIRONMENT ON
DEVELOPING MICE PRIMORDIAL GAMETOCYTES
AND ITS INFLUENCE ON GENETIC IMPRINTING
Jim Weakley
York College of Pennsylvania, Department of Biological Sciences
(Kalthoff, 2001)
Project Summary:
Much information is lacking about the process of genetic imprinting
in the testicular environment. This proposal will examine the effects of
imprinting within a testicular environment and whether the imprint is a
result of the cell maturing there. To study this, primordial oocycte nuclei
will be transplanted into enucleated primordial spermatocytes and
placed into the testicular environment by injection into the efferent ducts.
Maturing germ cells will be collected throughout the experiment to study
the methylated state of the Insulin-Like Growth Factor 2 (ILGF2) loci
using a new technique of Methylation Specific PCR (MSPCR.) Results
will then be studied to determine if the testicular environment
significantly influences the genetic imprint found at the ILGF2 site. If the
testicular environment influences the paternal imprint, studies can then
concentrate on this environment to further investigate the mechanisms
of genetic imprinting and the conditions involved.
Introduction:
• Gametes collected from the cauda of the recipient SCO ♂ will be
purified (by CsCl ethidium bromide gradient centrifugation in
accordance to Sanford, et. al. 1987 protocol.)
• It is hypothesized as primordial germ cells mature, their imprint is overwritten and methylated,
reflecting the sex of the species. Environmental control over imprinting has not been examined,
however, sertoli cell influence on spermatogenesis has clearly been shown to promote cell
maturation and growth (Ogawa, et. al. 2000.) It is feasible to believe that sertoli cells may have
the ability to influence or signal the methylation of certain genes.
• This proposal will use the techniques of MSPCR and transplantation of germ cells to determine
whether the testicular environment affects the paternal imprint found on the ILGF2 loci.
Objectives:
• Primer sequences (obtained from NCBI) for ILGF2 gene
(5’tacttattcaaaatataacc3’ and 5’cccaaactcaaaaaaaataa3’-unmethylated
sequence [Primer A]) will be used for half the mixture while primer
sequences (5’tacttgttcgaaatgtagcc3’ and 5’cccaggctcggaggaagtga3’methylated sequence [Primer B]) will be used for the remaining.
• Determine the methylation state of the maternal DNA on the ILGF2 loci placed in a testicular
environment.
• PCR products from each of the four groups will be electrophoresed
(Figure 3.)
Expected Results:
G
DNA
1
♀
Cell/DNA After
Transplantation
Cell/DNA After
Extraction
2
Experimental:
3
♂
2
3
4
A B
A B
A B
A B
MW
0bp
A- Unmethylated Primer Sequence used
B- Methylated Primer Sequence used
Figure 3: Group 1 (control) should reveal a
‘female’ ILGF2 imprint. In contrast, Groups
2, 3, and 4 should reveal a ‘male’ ILGF2
imprint.
•These results should demonstrate that neither cell nor nuclear
transplantation influences ILGF2 imprinting.
• These results should also demonstrate whether the testicular environment
can impose a ‘male’ ILGF2 imprint on a female genome or if the genetic
imprint is predetermined.
4
♂
1
1800bp
all unmethylated cytosines to uracil; methylated
cytosines will remain unchanged.
Controls:
• Recent cloning experiments have produced developing embryos with
supporting tissue, suggesting these active and inactive alleles are
conserved throughout the organism’s life within their somatic cells
(Kalthoff, 2001.)
•Future studies may further clarify whether imprinting is influenced by the
tissue matrix itself or the cytoplasm of the host cell.
♂
Literature Citied
♂
♀ Imprint
♂
♀
♂
♂
♂
Figure 1: Experimental design
Blue color indicates Female
♂ Imprint
Red color indicates Male
Symbols (♀ ♂) indicate DNA
Circles indicate primordial germ cells
(Kalthoff, 2001)
• A CpGenome™ DNA Modification Kit (with sodium bisulfite) (MSPCR)
will be used following the manufactures (Oncor, Inc.) instructions where
all unmethylated cytosines will convert to uracil while methylated
cytosines remain unchanged (Figure 2.)
• Homozygous mutant infertile sertoli cell only (SCO) ♂ mice and fertile normal ♂ and ♀ mice will
be acquired from Jackson Laboratory.
• A collection of primordial germ cells will be obtained and enucleated from normal ♂ and ♀ mice.
• Pronuclei of the ♀ primordial germ cells will be inserted into the enucleated ♂ primordial germ
cell, transplanted into a SCO ♂ testicular environment by injection into the efferent ducts, and
allowed to mature for six months.
• These techniques will be performed using Eppendorf Micromanipulator TransferMan, CellTram
Air, CellTram Oil or FemtoJet (Herman, et. al., 1996.)
• The controls and experimental groups will be designed as seen in Figure 1 below:
Figure 2: CpGenome Modification will convert
• Pronuclear transplantation experiments indicate that maternal and
paternal alleles are both needed for embryonic development and have
different activation states controlled by the methylation of their CpG
islands (imprinting.) (Kalthoff, 2001) (Table 1)
Pronuclear Transplantation Experiments with
Fertilized Mouse Eggs
• MSPCR is a new technique that allows researchers to differentiate between methylation states
of CpG islands on any gene of interest (Herman, et. al., 1996.)
Research Design and Methods:
Review of Literature:
Table 1
Research Design and Methods cont.
• Determine whether genetic imprints result from their environment or a predetermined state.
Environmental signaling has been shown to influence cell
functions regulated by gene sequences acquired from both parents.
Mendelian genetics specifies dominance rules for these alleles;
however, maternal and paternal alleles may not always be physically
expressible. For example, inherited methylated genes (imprints) are
not expressible, regardless of their dominance. This experiment will
test the influencing factors over one of these methylated alleles and
whether the imprinted gene can be changed. This will mark the
beginning of our understanding for environmental control over
imprinting.
• The insulin-like growth factor-2 (ILGF2) loci has been found
methylated only within female gametes and only expressed on the
paternal allele (Sanford, et. al., 1986.)
Review of Literature cont.
♀
Herman, J.G., Graff, J.R., Myohanen, S., Nelkin, B.D., Baylin, S.B. 1996. MethylationSpecific PCR: A Novel PCR Assay for Methylation Status of CpG Islands. Medical
Sciences V93 9821-9826.
Kalthoff, K. 2001. Analysis of Biological Development. 2nd ed. McGraw-Hill Company, New
York, NY.
Ogawa, T., Dobrinski, I., Avarbock, M.R., Brinster, R.L. 2000. Transplantation of Male
Germ Line Stem Cells Restores Fertility in Infertile Mice. V6:29-34.
♂ Imprint
♂ Imprint
Sanford, J.P., Clark, H.J., Chapman, V.M., Rossant, J. 1987. Differences in DNA
Methylation During Oogenesis and Spermatogenesis and Their Persistance during Early
Embryogenesis in the Mouse. Genes and Development V1:1039-1046.