Transcript String
Interoperability With BioMoby 1.0 It’s Better Than Sharing Your Toothbrush! Photo taken by http://flickr.com/people/mfsarwar/ A brief history of BioMoby • Model Organism Bring Your own Database Interface Conference, Sept, 2001 (MOBY-DIC) • May 21, 2002 – Genome Canada Platform Award • May 25, 2002 – API Version 0.1 deployed, including object ontology serialization into XML • July 18, 2002 – First Moby Client (Gbrowse Moby) • June 9, 2003 – API Version 0.5 deployed • 2006 – Genome Canada Platform Award • 2007 - Version 1.0 API submitted for publication MOBY-DIC Chapter VII 7th Model Organism Bring Your-own Database Interface Conference Vancouver, BC, June 2007. The Core Ahab’s Wendy Richard Martin Mylah Eddie Andreas Paul Ivan Mark’s Screen… The BioMoby Plan • • • • • Create an ontology of bioinformatics data-types Define a serialization of this ontology (data syntax) Create an open API over this ontology Define Web Service inputs and outputs v.v. Ontology Register Services in an ontology-aware Registry • Machines can find an appropriate service • Machines can execute that service unattended • Ontology is community-extensible Overview of BioMoby Transactions MOBY hosts & services Alignment Sequence Gene names Sequence Align Express. Phylogeny Protein Primers Alleles … MOBY Central Overview of BioMoby Transactions Discovery of services That consume things LIKE sequences! Sequence MOBY Central Align Phylogeny Primers A sequence is a ___ What is a sequence? That has these features __ Object ontology This is SCUFL – Simple Conceptual Unified Flow Language It is a complete record of everything you just did, and it can be saved for use in the Taverna workflow application that we will look at later… Pipeline discovery “on the fly” • No explicit coordination between providers • Dynamic discovery of ~appropriate Services • Automated execution of services Some BioMoby statistics Moby: Breadth • • • • Namespaces (data types): 418 Objects (data syntaxes): >561 Service Types (analytical categories): 112 Providers: ~50 active • Service Instances: ~1200 currently “alive” – In main Moby Central server in Canada – Others in “boutique” Moby registries serving specialized communities worldwide Moby: Clients • Gbrowse_moby (M Wilkinson) • PlaNet Locus_View (H Schoof, R Ernst) • Blue-Jay (P Gordon) • Taverna (T Oinn, M Senger, E Kawas) • MOWserv (INB, Spain) • Remora (S Carrere, J Gouzy, INRA) • MOBYLE (B Néron, P Tufféry, C Letondal, Pasteur Inst.) • SeaHawk (P Gordon) BioMoby in detail • MOBY Data typing system: Semantic Type • MOBY Data typing system: Syntactic Type • Moby Registry Queries BioMoby in detail • MOBY Data typing system: Semantic Type • MOBY Data typing system: Syntactic Type • Moby Registry Queries Moby Namespaces • A “Namespace” is a category of identifiers – NCBI has gi numbers (gi Namespace) – GO Terms have accession numbers (GO Namespace) • Namespaces indicate data’s semantic type. – GO:0003476 a Gene Ontology Term – gi|163483 a GenBank record • Though we are using the word “Namespace” correctly, it causes confusion! – “Namespace” in XML is tightly associated with an XML document and/or its syntax – In Moby, we are ONLY talking about data entities NOT THEIR SYNTAX BioMoby in detail • MOBY Data typing system: Semantic Type • MOBY Data typing system: Syntactic Type • Moby Registry Queries BioMoby in detail • MOBY Data typing system: Semantic Type • MOBY Data typing system: Syntactic Type • Moby Registry Queries The MOBY Object Ontology • Syntactic types are defined by a GO-like ontology – Class name at each node – Edges define the relationships between Classes – GO used as a model because of its familiarity in the community • Edges define one of three relationships – ISA • Inheritance relationship • All properties of the parent are present in the child – HASA • Container relationship of ‘exactly 1’ – HAS • Container relationship with ‘1 or more’ The Simplest Moby DataType <Object namespace=‘NCBI_gi’ id=‘111076’/> Object The combination of a namespace and an identifier within that namespace uniquely identify a data entity, not its location(s), nor its representation Moby Primitives ISA ISA ISA Object ISA DateTime Float Integer <Integer namespace=‘’ id=‘’>38</Integer> String A Derived Data-Type <VirtualSequence namespace=‘NCBI_gi’ id=‘111076’> <Integer id=‘’ articleName=“length”>38</Integer> <Integernamespace=‘’ namespace=‘’ id=‘’>38</Integer> </ VirtualSequence > ISA Integer HASA Object ISA ISA Describes the semantic relationship between the Integer and the Virtual Sequence String Virtual Sequence A Derived Data-Type <GenericSequence namespace=‘NCBI_gi’ id=‘111076’> <Integer namespace=‘’ id=‘’ articleName=“length”>38</Integer> <String namespace=‘’ id=‘’ articleName=“SequenceString”> <VirtualSequence namespace=‘NCBI_gi’ id=‘111076’> ATGATGATAGATAGAGGGCCCGGCGCGCGCGCGCGC <Integer namespace=‘’ id=‘’ articleName=“length”>38</Integer> </String> </ VirtualSequence > </ GenericSequence > ISA Object ISA ISA Integer HASA HASA String Virtual Sequence ISA Generic Sequence A Derived Data-Type <DNASequence namespace=‘NCBI_gi’ <GenericSequence namespace=‘NCBI_gi’ id=‘111076’> id=‘111076’> <Integer namespace=‘’ id=‘’ articleName=“length”>38</Integer> <String namespace=‘’ id=‘’ articleName=“SequenceString”> ATGATGATAGATAGAGGGCCCGGCGCGCGCGCGCGC </String> </ DNASequence GenericSequence > > ISA Object ISA ISA Integer HASA HASA String Virtual Sequence ISA Generic Sequence ISA DNA Sequence Legacy file formats • Containing “String” allows ontological classes to represent legacy data types <NCBI_Blast_Report namespace=‘NCBI_gi’ id=‘115325’> <String namespace=‘’ id=‘’ articleName=‘content’> TBLASTN 2.0.4 [Feb-24-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= gi|1401126 (504 letters) Database: Non-redundant GenBank+EMBL+DDBJ+PDB sequences 336,723 sequences; 677,679,054 total letters Searchingdone Sequences producing significant alignments: gb|U49928|HSU49928 Homo sapiens TAK1 binding protein (TAB1) mRNA... emb|Z36985|PTPP2CMR P.tetraurelia mRNA for protein phosphatase t... emb|X77116|ATMRABI1 A.thaliana mRNA for ABI1 protein </String> </NCBI_Blast_Report> Score (bits) E Value 1009 58 53 0.0 4e-07 1e-05 Binaries – pictures, movies • Text-base64 is a Class that contains String • Binaries are base64 encoded and passed in classes that inherit from textbase64 • base64_encoded_jpeg ISA text/base64 ISA text/plain HASA String <base64_encoded_jpeg namespace=‘TAIR_image’ id=‘3343532’> <String namespace=‘’ id=‘’ articleName=‘content’> MIAGCSqGSIb3DQEHAqCAMIACAQExCzAJBgUrDgMCGgUAMIAGCSqGSIb3DQEHAQAAoIIJQDCC Av4wggJnoAMCAQICAwhH9jANBgkqhkiG9w0BAQQFADCBkjELMAkGA1UEBhMCWkExFTATBgNV MIAGCSqGSIb3DQEHAqCAMIACAQExCzAJBgUrDgMCGgUAMIAGCSqGSIb3DQEHAQAAoIIJQDCC Av4wggJnoAMCAQICAwhH9jANBgkqhkiG9w0BAQQFADCBkjELMAkGA1UEBhMCWkExFTATBgNV BAgTDFdlc3Rlcm4gQ2FwZTESMBAGA1UEBxMJQ2FwZSBUb3duMQ8wDQYDVQQKEwZUaGF3dGUx HTAbBgNVBAsTFENlcnRpZmljYXRlIFNlcnZpY2VzMSgwJgYDVQQDEx9QZXJzb25hbCBGcmVl bWFpbCBSU0EgMjAwMC44LjMwMB4XDTAyMDkxNTIxMDkwMVoXDTAzMDkxNTIxMDkwMVowQjEf MB0GA1UEAxMWVGhhd3RlIEZyZWVtYWlsIE1lbWJlcjEfMB0GCSqGSIb3DQEJARYQamprM0Bt </String> </base64_encoded_jpeg> Extending legacy datatypes • • • • With legacy data-types defined, we can extend them as we see fit annotated_jpeg ISA base64_encoded_jpeg annotated_jpeg HASA 2D_Coordinate_set annotated_jpeg HASA Description <annotated_jpeg namespace=‘TAIR_Image’ id=‘3343532’> <2D_Coordinate_set namespace=‘’ id=‘’ articleName=“pixelCoordinates”> <Integer namespace=‘’ id=‘’ articleName=“x_coordinate”>3554</Integer> <Integer namespace=‘’ id=‘’ articleName=“y_coordinate”>663</Integer> </2D_Coordinate_set> <String namespace=‘’ id=‘’ articleName=“Description”> This is the phenotype of a ufo-1 mutant under long daylength, 16’C </String> <String namespace=‘’ id=‘’ articleName=“content”> MIAGCSqGSIb3DQEHAqCAMIACAQExCzAJBgUrDgMCGgUAMIAGCSqGSIb3DQEHAQAAoIIJQDCC Av4wggJnoAMCAQICAwhH9jANBgkqhkiG9w0BAQQFADCBkjELMAkGA1UEBhMCWkExFTATBgNV </String> </annotated_jpeg> The same object… annotated_jpeg ISA base64_encoded_jpeg HASA 2D_Coordinate_set HASA Description <annotated_jpeg namespace=‘TAIR_Image’ id=‘3343532’> <2D_Coordinate_set namespace=‘’ id=‘’ articleName=“pixelCoordinates”> <Integer namespace=‘’ id=‘’ articleName=“x_coordinate”> 3554 </Integer> <Integer namespace=‘’ id=‘’ articleName=“y_coordinate”> 663 </Integer> </2D_Coordinate_set> <String namespace=‘’ id=‘’ articleName=“Description”> This is the phenotype of a ufo-1 mutant under long daylength, 16’C </String> <String namespace=‘’ id=‘’ articleName=“content”> MIAGCSqGSIb3DQEHAqCAMIACAQExCzAJBgUrDgMCGgUAMIAGCSqGSIb3DQEHAQAAoIIJQDCC Av4wggJnoAMCAQICAwhH9jANBgkqhkiG9w0BAQQFADCBkjELMAkGA1UEBhMCWkExFTATBgNV </String> </annotated_jpeg> The same object… annotated_jpeg ISA base64_encoded_jpeg HASA 2D_Coordinate_set HASA Description <annotated_jpeg namespace=‘TAIR_Image’ id=‘3343532’> <CrossReference> <Object namespace=“TAIR_Allele” id=“ufo-1”/> </CrossReference> <2D_Coordinate_set namespace=‘’ id=‘’ articleName=“pixelCoordinates”> <CrossReference> <Object namespace=‘TAIR_Tissue’ id=‘122’/> </CrossReference> <Integer namespace=‘’ id=‘’ articleName=“x_coordinate”> 3554 </Integer> <Integer namespace=‘’ id=‘’ articleName=“y_coordinate”> 663 </Integer> </2D_Coordinate_set> <String namespace=‘’ id=‘’ articleName=“Description”> This is the phenotype of a ufo-1 mutant under long daylength, 16’C </String> <String namespace=‘’ id=‘’ articleName=“content”> MIAGCSqGSIb3DQEHAqCAMIACAQExCzAJBgUrDgMCGgUAMIAGCSqGSIb3 Av4wggJnoAMCAQICAwhH9jANBgkqhkiG9w0BAQQFADCBkjELMAkGA1U </String> </annotated_jpeg> Cross reference types • Simple – A MOBY Object • Rich <Object namespace=‘foo' id=‘12345‘/> – Takes the form: <Xref namespace='' id='' authURI='' serviceName='' evidenceCode='' xrefType=''> ... Textual Description ... </Xref> – …Incidentally, this avoids the problem of reification that is experienced in RDF XML Schema? The Object Ontology allows new data-types WITHOUT new flatfile formats, and without having to understand e.g. XML Schema Minimize future heterogeneity Improve interoperability without requiring schemato-schema mapping XML Schema? • Object Ontology terms have semantically rich names, but this is primarily for human intuition – DNA Sequence – Annotated_GIF • Object Ontology does not define the meaning of an object to the machine – No machine-readable semantics • It does define the representation – SYNTAX A portion of the MOBY-S Object Ontology …community-built! BioMoby in detail • MOBY Data typing system: Semantic Type • MOBY Data typing system: Syntactic Type • Moby Registry Queries A Moby Central Query • Give me: – Services that consume THIS data-type in THIS syntax… – …do SOMETHING LIKE THIS to it… – …and provide me THAT data-type in response Example • Find me services that – consume FASTA sequence data, – do a BLAST with it, – and provide me lists of GenBank GI numbers in return. • Query can be any or all of the above criterion – Also limit by service provider and service description keyword Remember!! Moby Registry Query INPUT TYPE | | TRANSFORMATION TYPE | | OUTPUT TYPE A weakness of MOBY Service discovery is horribly flawed due to insufficiently rich semantics… The problem with Moby Chickens go in; Pies come out! The problem with Moby What sort o’ pies? The problem with Moby Apple! The MOBY-S Service Ontology • A simple ISA hierarchy… – too simple! • Primitive types include: – – – – – – – Analysis Parsing Registration Retrieval Resolution Conversion Rendering A slice of the Service Ontology Parse_NCBI_Blast “The Exploding Bicycle” - A. Rector, U Manchester Parsing Parse_WU_Blast Service WU_Blast Analysis Alignment Blast NCBI_Blast Summary so far • BioMoby uses ontologies to describe both data types and data syntaxes – This is where the interoperability comes from – These are used to match consumers with providers during service discovery • BioMoby uses a simple ontology to describe bioinformatics operations – This ontology is only marginally useful Seahawk • Highlight data in your browser and drag/drop it into Moby • What could be easier than that?! Paul MK Gordon and Christoph W Sensen BMC Bioinformatics 2007, 8:208 Seahawk: A New Moby Client for Biologists Drag ‘n’ drop, highlight existing data for use with MOBY Services Paul Gordon & Christoph Sensen BMC Bioinformatics, in press Seahawk looks like a browser How do I load data? How do I load data? How do I load data? • Use the “open” button: – – – – Text file (e.g. FASTA sequences) HTML page (e.g. NCBI Entrez Web page) RTF document (e.g. conference abstract) MOBY XML document • Drag ‘n’ Drop – Web links and desktop files – Highlighted text from open documents or Web pages Under the Hood (Beneath the Bonnet?) • Data has to be converted into Moby XML format to be used by Moby • Moby data has to be converted back to human-readable text for presentation to the biologist Again: How do I load data? How do I Find Services? • Right-click MOB rules are invoked • Resulting Moby XML is used for service search How do I run a service? • Click it! • If necessary, a service’s extra parameters can be set • Control+click submits using default params How do I run a service? • If required inputs are missing, the missing ones must be dragged into place. • Unrecognized data will be rejected How do I collate data? • Seahawk clipboard lets you build collections of objects • Seahawk “knows” the type of collection and will suggest appropriate Moby services Seahawk Summary • Seahawk integrates Moby Web Service discovery and execution into the biologists day-to-day “Web Surfing” activity • It uses Regular Expressions and XSLT to move normal web or hard-drive-file data into and out of BioMoby Why doesn’t Moby Use RDF/OWL? Timeline of Moby/W3C Activities RDF Candidate Spec RDF/OWL Formal W3C Recommendations W3C Launches Semantic Web (SW) Activity Group RDF Schema Candidate Spec Extensive SW toolbuilding… >>>>>> 2000 2001 2002 2003 2004 2005 2006 BioMoby XML Finalized BioMoby Project Established BioMoby Stable 0.85 API Published (>400 services) BioMoby Stable 1.0 API Published Moby 2.0 Getting it right, the second time! What BioMoby Already Does Sequence Data Blast Hit BLAST SERVER What BioMoby Already Does givesBlastResult Sequence Data Blast Hit Not “Bologically” Meaningful What BioMoby Already Does Sequence Data hasHomologyTo Blast Hit …looks a lot like… URI hasHomologyTo Which is effectively just an RDF triple, URI Now think in reverse… (in case you forgot…) Moby Registry Query INPUT TYPE | | TRANSFORMATION TYPE | | OUTPUT TYPE Moby 2.0 What does Sequence Data Have homology to? hasHomologyTo Maps to Send data Blast Hit BLAST SERVICE Query FIND SERVICES THAT Consume Sequence Data | | Provide hasHomologyTo Property | | Attached to other Sequence Data SPARQL • A Semantic Web query language • Queries “look like” graphs Find “X” with predicate “Y” attached to “Z” Moby 2.0 extends the SPARQL query language • SPARQL queries contain concepts and the relationships between them (subject, predicate, object) • We simply map RDF predicates onto Moby services capable of generating that relationship • Registry query: “What Moby service consumes [subject] and generates the [predicate] relationship type?” But wait, there’s more! Exploit knowledge in OWL ontologies to enhance query Predicate Subject Subject Predicate Evaluate Query Expression Look up and execute Moby service Consumes STK or proteins and Looks-up inhibitor molecules Look up and execute Moby service Consumes proteins and generates Functional annotation info Exploit knowledge in OWL ontologies to enhance query This SPARQL query could be posed on a database of RAW, UNANNOTATED Protein sequences, and be answered by Moby 2.0 (a.k.a. CardioSHARE) Credits • Genome Canada/Genome Alberta • myGrid – Carole Goble in particular • Spanish National Institute for Bioinformatics (INB) through Fundación Genoma España • Generation Challenge Programme (GCP) of the Consultative Group for International Agricultural Research (CGIAR) • Heart and Stroke Foundation of BC and Yukon (CardioSHARE) • Microsoft Research (CardioSHARE)