Transcript MB206_fhs_lnt_007a_AT_Jan09

Polymerase Chain Reaction
What is PCR
History of PCR
How PCR works
Optimizing PCR
Fidelity, errors & cloning
PCR primer design
Application of PCR
What is PCR?
• It’s a means of selectively amplifying a
particular segment of DNA.
• The segment may represent a small part
of a large and complex mixture of DNAs:
e.g. a specific exon of a human gene.
• It can be thought of as a molecular
photocopier.
Now used for:
Cloning
Analysis of gene expression
SNP detection
Mutagenesis
The Invention of PCR
• Invented by Kary Mullis
in 1983.
• First published account
appeared in 1985.
• Awarded Nobel Prize for
Chemistry in 1993.
Did He Really Invent PCR?
• The basic principle of replicating a piece of
DNA using two primers had already been
described by Gobind Khorana in 1971:
– Kleppe et al. (1971) J. Mol. Biol. 56, 341346.
• Progress was limited by primer synthesis
and polymerase purification issues.
• Mullis properly exploited amplification.
A Molecular
Photocopier
A photocopier
capable of
duplicating a part of
a sentence
– “The next day was quite a different day. Instead of being hot and
sunny, it was cool and misty. Pooh didn’t mind for himself, but
when he thought of all the honey the bees wouldn’t be making, a
cold misty day always made him feel sorry for them.” A.A. Milne,
1928.
How Powerful is PCR?
PCR can amplify a usable amount of DNA
(visible by gel electrophoresis) in ~2 hours.
The template DNA need not be highly
purified — a boiled bacterial colony.
The PCR product can be digested with
restriction enzymes, sequenced or cloned.
PCR can amplify a single DNA molecule,
e.g. from a single sperm.
Gene Analysis Prior to PCR?
Southern blotting (1975) permitted
rudimentary mapping of genes in unrelated
individuals (RFLPs, insertions & deletions).
DNA sequencing (1978) required genes to
first be cloned into plasmid or λ vectors.
Gene library construction and screening
could take many months and libraries had
to be made for each individual analysed.
Heat-stable DNA polymerase
• Taq DNA polymerase
was isolated from the
bacterium Thermus
aquaticus.
• Taq polymerase is
stable at the high
temperatures (~95oC)
used for denaturing
DNA.
Hot springs at Yellowstone
National Park, Wyoming.
Limitations of Taq Polymerase
• Error rate for Taq= 1/5000 nucleotides
• Does not have 3’
proofreading.
5’ exonuclease activity for
• Pfu DNA polymerase can be substituted for Taq
polymerase for better proofreading due to 3’ 5’
exonuclease activity. Pfu is slower than Taq and
more expensive.
Limitations of Taq Polymerase
• Pfu gives blunt end PCR products. (Use blunt
end cloning strategy).
• Taq adds an extra “A” to the 3’ end of PCR
products. (Use “T-A” cloning vectors)
• Pfu can remove “A overhangs” on Taq PCR
products.
Components
– Heat-stable DNA polymerase (Taq polymerase)
– Two Primers (DNA oligonucleotides)
– Deoxynucleotides –dATP, dTTP, dCTP, dGTP
– DNA template
– Mg++, buffer components, and water
Primers
• Two oligonucleotides of different sequences.
• Each are typically 18-25 nucleotides long.
(Forward & Reverse)
• Primers complementary base pair (“hybridize”
or “anneal”) to template DNA.
General Example of Primers
http://www.bio.davidson.edu/Courses/Molbio/MolStudents/spring2002/Robinson/Isocitrate-main-page.html
Lux AB Primers
3’ TACTTCAAACCTTTATAAAC 5’
5’ CACCATGAAGTTTGGAAATATTTG 3’
(Forward Primer)
(Reverse Primer)
3’ TTTTAGCTTTACTTAAATGG 5’
5’ AAAATCGAAATGAATTTACC 3’
Forward Primer = nucleotides 4230-4249 in template (+ 4 additional nucleotides)
Reverse Primer = nucleotides 6290-6310 in template
Total length PCR product = 2080 base pairs long
Review: Annealing Temperature
• The primer annealing temperatures typically
range from 55-65oC based on length and G-C
content. (Ours are 56oC [Forward] and 47oC [R])
• Annealing temp should be a few degrees below
the lowest melting temperature (Tm) for the two
primers. (Ours is 48oC)
• Tm of two primers should be within 5oC of each
other. (Ours are 56oC and 47oC)
Tips: Successful Primer Design
• 3’ end should have exact homology to the
template DNA.
• Try to have 50-60% G-C composition.
• Avoid complementary base pairing within the
primer (“stem-loop” or “hairpins”).
• If possible, avoid primer-dimer formation.
Hairpin Structure
TC
C AGAAGGTGACCAAGTTCAT-3’
I I I I I I I
C TCTTCCA-5’
CA
Primer-Dimers
Check Your Knowledge
• 3’ GCATTGCTACAT 5’
(Only 12 nucleotides long. Should be at least 18 nucleotides in length)
• 3’ GCCGGAGTCTGGCGCGCGCGC ‘5
(Too G-C rich. Will have a high Tm value.)
• 3’ GGGGATTCTACCCCACGATATAGCA-5’
(Hairpin formation between GGGG and CCCC. Also, you want to avoid 4 or
more G’s or C’s in a row.)
Primers
• Good primers critical for quality
amplifications
• Define the target region to be amplified
• May be taxon specific
• May be universal-widely applicable across
taxa
• Universality can be achieved through
degeneracy, or by sitting on conserved
region
Characteristics of Good Primers
1. Should be specific:
– Sixteen base sequence will statistically be
present only once in every 416 bases
(=4294967296, or 4 billion), about equal to the
human genome
2. Should anneal at 50oC or above – a
function of length and GC content
Primer annealing temperatures
assuming 50-50 AT-GC content
Characteristics of Good Primers
3. Should have high specificity on 3’ (extension) end
- Often helped by ending primer sequence with GC
content
4. Should not include palendromic sequences
(will form hairpin loops)
5. Primer annealing temps within 5o C of each other
6. Should not have inter primer homologies
- results in primer dimers
7. Between 40-60% GC content
8. No Poly C or G- result in non specific binding
• from high bond energy
Designing PCR Primers
• Primers should be ~20 bases long.
• The G/C content should be 45–55%.
• The annealing temperatures should be
within 1°C of one another.
• The 3´-most base should be a G or C.
• The primers must not base pair with each
other or with themselves or form hairpins.
• Primers must avoid repetitive DNA
regions.
Primers That Form Hairpins
• A primer may be self-complementary and
be able to fold into a hairpin:
5´-GTTGACTTGATA
||||| T
3´-GAACTCT
• The 3´ end of the primer is base-paired,
preventing it annealing to the target DNA.
Primers That Form Dimers
• A primer may form a dimer with itself or
with the other primer.
5´-ACCGGTAGCCACGAATTCGT-3´
||||||||||
3´TGCTTAAGCACCGATGGCCA-5´
• Primer dimers can be an excellent, but
unwanted, substrate for the Taq
polymerase.
Help With Primer Design
• Researchers agreed early on that the
design of PCR primers was difficult and
unreliable.
• Computer programs devised to take all of
the design criteria into account.
• Primer3 program at the Whitehead
Institute is the most reliable and versatile
tool currently available.
Primers for a COL3A1 variant
• The human COL3A1 gene has a variant at
amino acid 531 of the triple helix.
• Ala or Thr encoded in exon 31 of the gene.
• AluI restriction enzyme site present in the
Ala allele but absent in the Thr allele.
• PCR amplify the region and genotype by
digestion of PCR products with AluI.
Running Primer3
• Paste the DNA sequence into Primer3 with
the “target” enclosed in square brackets.
• Select a mispriming library — only human
and rodent available at present.
• Select option for a 1-base 3´ “GC Clamp”.
• Select PCR product size range (>600 bp).
• Click the “Pick Primers” button.
• Marvel at the ease and simplicity.
The COL3A1 Ala/Thr PCR
• The PCR primers amplify from the start of
exon 31 to just beyond exon 33 — 656 bp.
• Ala alleles are digested by AluI, producing
fragments of 82 & 574 bp.
Will Other Genes Amplify Too?
• The primers have been designed on the
basis of the DNA sequence of a single
gene.
• Might the primers also amplify other
segments whose sequence we have not
taken into account?
• Need to consider the sequence of the
entire genome to answer this.
Virtual PCR Results
• Virtual PCR searches entire genome
looking for potential primer sites within
10,000 bases of one another.
• If found, it performs a virtual PCR reaction.
• Primers for Ala/Thr polymorphism in
human COL3A1.
Components
– Heat-stable DNA polymerase (Taq polymerase)
– Two Primers (DNA oligonucleotides)
– Deoxynucleotides –dATP, dTTP, dCTP,
dGTP
– DNA template
– Mg++, buffer components, and water
Deoxynucleic Acids
• dATP, dTTP, dGTP and dCTP should be
present in equal amounts.
• 10X dNTP mix is the least stable
component.
– Store frozen in small aliquots
– Keep dNTP’s on ice!
Components
– Heat-stable DNA polymerase (Taq polymerase)
– Two Primers (DNA oligonucleotides)
– Deoxynucleotides –dATP, dTTP, dCTP, dGTP
– DNA template
– Mg++, buffer components, and water
Template DNA
• Minimum…50,000 copies/PCR reaction (2
Kb fragment = 0.1 pg)
• 1ng-1µg template DNA
– Higher concentrations for total genomic
– Lower concentrations for plasmid DNA
• Use 20ng of lux operon plasmid
Template DNA
• Always add template DNA last to your reaction
vial to avoid contamination.
• Always run controls
–
–
–
–
–
(+) cloned template (if available)
(-) water only control
(-) vector only control (pGEM)
(-) forward primer control
(-) reverse primer control
Components
–
–
–
–
Heat-stable DNA polymerase (Taq polymerase)
Two Primers (DNA oligonucleotides)
Deoxynucleotides –dATP, dTTP, dCTP, dGTP
DNA template
– Mg++, buffer components, and water
Mg++, Buffer, and Water
• Mg+2 is an essential cofactor for Taq & Pfu
DNA polymerase activity. Final [Mg+2] =
1.5mM
• 10X PCR buffer=100mM Tris, pH 8.3 +
500mM KCl.
Mg++, Buffer, and Water
• Water should be ultrapure (MilliQ water)
with no salts or DNA contamination.
• Template DNA and primers should be
resuspended in MilliQ water to avoid high
concentrations of EDTA.
The Basics of PCR Cycling
• 30–35 cycles each
• comprising:
– denaturation
(95°C),30 sec.
– annealing (55–
60°C), 30 sec.
– extension (72°C),
• time depends on
product size.
How does PCR work?
One PCR Cycle:
How does PCR work?
• One PCR cycle: What the products
really looks like…
Template Strand
4 DNA strands
Template Strand
Biology Animation Library: http://www.dnalc.org/ddnalc/resources/pcr.html
How does PCR work?
• Two cycles: What the products really
looks like…
8 DNA strands
How does PCR work?
• Three cycles…
16 DNA strands
Notice the production of double stranded, shortened PCR products (target sequence) that spans
the two primers. Our target sequences will contain the LUX AB genes.
How does PCR work?
• Four cycles…
32 DNA strands
The number of DNA strands doubles after each cycle. Target sequence predominates.
How does PCR work?
After 30
cycles…
Target sequence increases exponentially.
What’s in the Reaction?
• Template DNA
• Reaction buffer (Tris, ammonium ions
(and/or potassium ions), magnesium ions,
bovine serum albumin)
• Nucleotides (dNTPs)
• Primers (Forward & Reverse)
• DNA polymerase (usually Taq)
How many cycles?
• Increasing the cycle number above ~35
has little positive effect.
• The plateau occurs when:
– The reagents are depleted
– The products re-anneal
– The polymerase is damaged
• Unwanted products
accumulate.
Thermal Cyclers
• PCR cyclers available from many
suppliers.
• Many block formats and multi-block
systems.
• Reactions in tubes or 96-well micro-titre
plates.
Has It Worked?
•
•
•
•
•
Check a sample by gel electrophoresis.
Is the product the size that you expected?
Is there more than one band?
Is any band the correct size?
May need to optimize the reaction
conditions.
Optimising the PCR Reaction
•
•
•
•
•
•
Annealing temperature of the primers.
The concentration of Mg2+ in the reaction.
The extension time.
(The denaturing and annealing times.)
(The extension temperature.)
(The amount of template and polymerase
—“more is less”.)
Optimising the Annealing
Temperature
• Primers have a calculated annealing
temperature (e.g. 54°C).
• Temperature must be confirmed
practically.
• Temperature steps of 2°C above and
below.
• Use gradient cycler.
Optimising the Mg2+
Concentration
• The fidelity of the PCR depends on
[Mg2+].
• Vary [Mg2+] in steps of 0.5 mM.
• Sometimes a compromise between yield
and specificity.
Do Errors Matter?
• Yes, if you want to clone the amplified
DNA — an individual molecule may
harbour several mutations.
• No, if you want to sequence the amplified
DNA or cut it with restriction enzymes.
• Use a proof-reading thermo-stable
enzyme rather than Taq.
TA Cloning of PCR Products
• Take advantage of the non-templated
bases.
• Linearise vector at a blunt-ended site (e.g.
EcoRV).
• Incubate linear vector with Taq
polymerase and dTTP to add nontemplated Ts.
• Ligate:
Special PCR Techniques
• HotStart: Adding Taq to PCR reaction
once reaction has exceeded annealing
temp (usually 80 C)
• Increases specificity of primer binding.
• Decreases non-specific products
Special PCR Techniques
• Nested PCR: Amplifying a PCR product
(typically from highly specific primers) from
within another PCR product (usually
amplified with more general primers)
• Increases quantity of target sequence for
amplification
Special PCR Techniques
• Re-amplification: Re-amplifying an
identical PCR product to increase product
- Often done from a weak band on a gel
***Can seriously increase error prone
products
Special PCR Techniques
• TouchDown: Gradually decreasing the
annealing temp throughout a reaction
• Increases specificity early on in reaction
while favoring highly efficient priming later
on.
Advantages of PCR
1. Works with small amounts of DNA (a
single molecule is sufficient)
2. Primers can be designed to any sequence
3. Reaction products easily visualized
Disadvantages of PCR
• Designing primers require a prior
knowledge of DNA sequence
• Difficult to amplify long segments
• Easy to contaminate
• High error rate in Polymerases
• Black magic-when it doesn’t work, you
never really know why
Applications of PCR
• Mutation testing, e.g. cystic fibrosis.
• Diagnosis or screening of acquired
diseases, e.g. AIDS.
• Genetic profiling in forensic, legal and
biodiversity applications.
• Site-directed mutagenesis of genes.
• Quantitation of mRNA in cells or tissues.
To be
Continue