Transcript Mutation
Genetic Drift: Extreme Example Parents A1 A2 A1 A3 A2A1 A1A1 A1A3 A2A3 A1A1 A1A3 A2A1 A1A3 A2A3 A1A1 Offspring Some possible outcomes all alleles survive A3 lost A2 lost A1 lost A2 and A3 lost When is genetic drift important? When populations undergo dramatic declines (bottleneck effect) • Cheetahs • Whooping Cranes (down to 13 individuals at one time) • Pere David’s Deer • Northern Elephant Seal When a small number of individuals establish a new population (founder effect) Drift: Bottleneck Effect A1 A2 A3 A4 A5 A6 A7 A8 A9 A A 10 11 N = 10,000 11 alleles A1 ? N=2 4 alleles A5 A9 A8 N = 10,000 4 alleles When a population is reduced to a few individuals they cannot represent all of the alleles of the original population’s gene pool. Bottleneck effect on Northern Elephant Seals --hunters reduced pop. to 20 in 1890 --protection allowed pop. to recover to 30,000 **no variation at 24 allozyme loci **two mitochondrial DNA haplotypes as compared to 23 in Southern Elephant Seals **still at risk of extinction due to disease etc. Drift: Founder Effect A1 A2 A3 A4 A5 A6 A7 A8 A9 A A 10 11 2 individuals start a new population ? Maximum of 4 alleles 11 alleles at one locus When a few individuals (or one seed, or one pregnant female) colonize a new habitat they cannot represent all of the alleles of the source population. One important effect of genetic drift is a decrease in heterozygosity Cheetahs and other endangered species have little or no allelic diversity Genetic drift has caused some alleles to disappear entirely Two important features of genetic drift The evolutionary change is random Genetic drift is more pronounced in small populations Migration In population genetics, migration refers to gene flow - the movement of alleles rather than seasonal movement of animals The result of migration is to equalize allelic frequencies among populations Migration therefore can counteract genetic drift Mutation The only evolutionary mechanism that produces new alleles Mutation therefore increases genetic diversity in a population However, mutation does not occur quickly enough to be a useful tool for conservation biologists • The highest mutation rates is about 1 in every 2,000 gametes • That means, about 1 in 1000 offspring would carry the mutant allele • On its own, mutation does little to change gene frequencies Types of mutations Point mutations • Caused by failure of DNA polymerase to correct a mismatched base pair • In some cases, mutations are inconsequential (silent mutations). • Suppose a point mutation arises and the codon CTT mutates to CTC • Both triplets code for the same amino acid (glutamic acid) • In other cases, a point mutation can make a huge difference • Human sickle cell anemia is caused by a single point mutation • The triplet CTC mutates to CAC, coding for valine rather han glutamic acid Sickle Cell Anemia The substitution of a single valine for glutamic acid in the hemoglobin molecule causes the hemoglobin to crystallize when oxygen concentrations are low The result is that the red blood cells become sickle-shaped instead of biconcave round cells The sickled red blood cells have a difficult time passing through capillaries The reduced blood flow causes anemia and intense pain Types of mutations Point mutations Changes in nucleotide number in a gene • Insertions of nucleotides - interrupt reading frame • CTCAGGTCCTGCTAACCTA • Insert a T after CTC • CTCTAGGTCCTGCTAACCTA • Almost always dysfunctional • Deletions - interrupt reading frame; also almost always dysfunctional Types of mutations Point mutations Changes in nucleotide number in a gene Chromosomal mutations - usually occur during crossing over • Deletion - removal of one or more genes • Duplication - addition of second copy of one or more genes • Inversion - reversal of order of one or more genes • Translocation - movement of one or more genes to a non-homologous chromosome Chromosomal mutations 1. Deletions 2. Duplications 3. Inversions 4. Translocations