Transcript GENETICS
GENETICS Pedigrees, Mutations and Karyotypes Pedigree Chart that shows how a trait and the genes that control it are inherited within a family Female Male Affected Person Carrier Marriage Connects Children & Parents Twins Homozygous Recessive Disorders Must have two recessive genes to have the disorder Examples: Tay-Sachs: the body can’t break down a certain lipid so it builds up in the brain; it is a fatal disorder Cystic Fibrosis: excess mucus accumulates in the digestive tract and lungs Dominant Allele Disorders Rare because the offspring usually dies before sexual maturity is reached If you have at least one dominant gene, you have the disorder Huntington’s disease: disorder in which the brain deteriorates; doesn’t show symptoms until an individual is in his late 30’s or early 40’s Genetic Counseling If a disorder is present in past family members, genetic counselors can give parents the probability of passing the genetic disorder to their children Genetic counselors construct pedigrees and use tests (i.e. alphafetoprotein, PKU) to determine probabilities Mutations Changes in the DNA that can involve one or more genes; Mutations can be: Harmful: cause diseases or deformities Helpful: organism is better able to survive Neutral: organism is unaffected If a mutation occurs in a sperm or egg cell, that mutation is passed onto offspring If a mutation occurs in a body cell, that mutation affects only the organism and is not passed onto offspring Gene Mutations Random changes in the sequence of nucleotides in DNA It’s a mistake that’s made during replication or transcription There are 4 types: Base Substitution Base Deletion Base Insertion Jumping Gene Base Substitution One base is replaced by another base; this is also called a point mutation ACGUCAGUA Threonine—Serine—Valine ACGUUAGUA Threonine—Leucine—Valine Depending on where the mutation occurs, it may have no affect on the protein ACGUCAGUA Threonine—Serine—Valine ACGUCGGUA Threonine—Serine—Valine Wobble: Base pairing between codon and anticodon in which there is nonstandard pairing at the third position of the codon; allows more than one codon to pair with the same anticodon Base Deletion Deletion of a base that disrupts the codons; also called a frameshift mutation ACGUCAGUA Threonine—Serine—Valine ACGUAGUAC Threonine--STOP Base Insertion Insertion of a base that disrupts the codons; also called a frameshift mutation ACGUCAGUAC Threonine—Serine— Valine ACGUCGAGUAC Threonine—Serine– Serine Jumping Genes Occur when large stretches of DNA are inserted into the gene; this can disrupt the DNA sequence ACGTCAGTAC ACGTCTACTGACGTAAGTAC Chromosomal Mutations Involve the entire chromosome Deletion: a chromosome breaks and a piece of the chromosome is lost Chromosomal Mutations (cont.) Duplication: part of a chromosome breaks off and is incorporated into its homologous chromosome; the homologous chromosome now has an extra copy of one of its parts Chromosomal Mutations (cont.) Translocation: a part of a chromosome breaks off and attaches to a different, nonhomologous chromosome Chromosomal Mutations (cont.) Inversion: a part of a chromosome breaks off, turns around, and reattaches in the reverse order Genome & Karyotype Genome: base sequence of all of the DNA in an organism Karyotype: photograph of all of an organism’s chromosomes Nondisjunction Failure of the chromosomes to separate during cell division If it occurs during mitosis, the individual cell is affected, but the organism is not usually harmed If it occurs during meiosis, the entire organism is affected Monosomy & Trisomy Monosomy: the zygote has only one copy of a particular chromosome Trisomy: the zygote has three copies of a particular chromosome In humans, monosomy and trisomy are so disruptive in most chromosomes that it kills the embryo In some chromosomes, however, the embryo survives, but it has developmental difficulties Diseases Caused by Nondisjunction Down’s Syndrome Caused by trisomy of chromosome 21 Symptoms include mental retardation and a “moon” face Trisomy 18 Caused by trisomy of chromosome 18 Symptoms include a webbed neck, severe mental retardation, and hernia (inguinal, umbilical, and diaphramatic) 90% mortality by 1 year Diseases Caused by Nondisjunction (cont.) Klinefelter’s Syndrome Caused by trisomy of the sex chromosomes, XXY Symptoms include lack of facial and body hair, rounded body type, and infertility Turner’s Syndrome Caused by monosomy of the sex chromosomes, XO Symptoms include no sexual development, learning disabilities, infertility, heart & kidney abnormalities Diseases Caused by Nondisjunction (cont.) Trisomy 13 Caused by trisomy of chromosome 13 Symptoms include severe mental retardation and hernias (inguinal and umbilical) 72% mortality by 1 year Polyploidy Nondisjunction occurs in all chromosome pairs Almost always lethal in animals Usually has a positive effect in plants Constructing a Pedigree Construct a pedigree using the following information. Make sure to shade in the affected individuals and carriers. Number each generation with Roman numerals (I, II, III, etc.) and each individual in a generation with Arabic numerals (1, 2, 3, etc.) Write each individual’s genotype under their symbol.