Evidence of Evolution - UCI - School of Biological Sciences

Download Report

Transcript Evidence of Evolution - UCI - School of Biological Sciences

Evidence of Evolution
Exploring Various Lines of
Evidence for the Theory of
Evolution
Lines of Evidence
•
•
•
•
•
•
DNA Sequences
Comparative Anatomy
Embryology
Transitional Fossils
Biogeography
“Genetic Tool Kit”
DNA Sequences
• Scientists are able to isolate pieces of
DNA and determine the actual sequence
of nucleotides
• Species that are more closely related tend
to have more similarities in their DNA
DNA Sequences
• Leptin = protein hormone that is important
for regulating body weight and metabolism
• Mice without properly functioning leptin
gene are morbidly obese (right) compared
to normal mice (left)
Leptin protein
DNA Sequences
• Compare actual sequences of DNA (leptin
gene) between three different species=
human, chimpanzee, mouse
• Predictions: how much similarity will there
be? Who will be most closely related?
DNA Sequences
• First 60 nucleotides:
Human: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct
Chimp: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct
Mouse: gaggga tcc ctgctccagc agctgcaagg taaggcccggggcgcgctact ttctcctcca
(Mouse sequence has been shifted to line up as much as possible.)
REMEMBER: Mutations can arise in the DNA sequence in a
variety of forms, including nucleotide replacement, insertion,
deletion, sequence inversion, etc.
DNA Sequences
• Nucleotides 121-180:
Human: agtcaggagg gatgcagggc ggatggctta gttctggact atgatagctt tgtaccgagt
Chimp: agtcaggagg gaggcagggc ggatggctta gttctggact atgatagctt tgtaccgagt
Mouse: aggtcatgtg gacagcttgg tgttgaattc agtagttttg cagcgaggga ctctgcagac
Note how the mouse sequence compares, after so many
mutations have accumulated.
REMEMBER: Mutations can arise in the DNA sequence in a variety of forms,
including nucleotide replacement, insertion, deletion, sequence inversion,
etc.
(Human and Chimp sequences are identical between nucleotides 61-120.)
Comparative Anatomy
Similarities in structures
between species
suggest they
descended from a
common ancestor.
Note the color-coded
bones for the limbs of
these 4 mammals –
though different, they
share many similar
bones. Describe the
function of each
animal’s limb on your
handout.
Comparative Anatomy
• http://www.eskeletons.org/
• Click “Comparative Anatomy” link
• Compare: human, chimpanzee, and
squirrel monkey
• Predictions: Who would be the most
similar and why? What similarities and
differences might you expect?
• Follow the directions on your handout!
Embryology
Ernst von Baer (1828): the more closely
related any two species are, the more
similar their development as embryos.
In this game, you will look at pictures of
embryos and guess what animal it is.
Is it a snake, chicken, possum, cat, bat
or human?
Write your guess down on your handout,
before you look at the answer!
Embryology
Are you sure
that’s
your
Snake!
prediction?
Embryology
Are you sure
Bat!
that’s your
prediction?
Embryology
Are you sure
Cat!
that’s your
prediction?
Embryology
Are you sure
Chicken!
that’s
your
prediction?
Embryology
Are you sure
Human!
that’s
your
prediction?
Embryology
Are you sure
Possum!
that’s your
prediction?
Biogeography
•Biogeography
Marsupial distribution
is the study
across
of thethe
large-scale
globe:
http://evolution.berkeley.edu/evolibrary/arti
or
global pattern of distribution of species,
cle/0_0_0/lines_11
including
the history and causes of this
• distribution.
Distribution today split on two sides of
For
globe
this –
activity,
how? you will explore the history
cause
behind
distribution
of and
• and
Review
a few
factsthe
of the
distribution
marsupials.
marsupials, as well as the history of the
Earth, then formulate hypothesis behind
distribution
Biogeography
•Marsupials
Marsupialare
distribution
a group of
across
mammals
the globe:
that
http://evolution.berkeley.edu/evolibrary/arti
give
birth to live young that develop in an
cle/0_0_0/lines_11
outer
pouch of the mother. Bandicoot
• Distribution today split on two sides of
globe – how?
• Review a few facts of the distribution and Koala
marsupials, as well as the history of the
Earth, then formulate hypothesis behind
Opossum
distribution
Sugar Glider
Kangaroo
Biogeography
There is no evidence of any marsupials able to swim across the
ocean. No marsupial has been observed wandering across
the Asian mainland. There does not appear to be any route of
migration between the two populations of marsupials. How do
you think some marsupials ended up halfway across the world
from the others?
Biogeography
Continental Drift over millions of years – watch
the movement of land masses
Biogeography
Continental Drift + Distribution of Marsupials
Biogeography
Similar reptilian Mesosaurus fossils found in
both South America and Africa  evidence
of continental drift
(couldn’t swim the ocean, no land bridge 
continents once joined)
Biogeography
Similar reptilian Mesosaurus fossils found in
both South America and Africa (couldn’t swim
the ocean, no land bridge)
 evidence of continental drift (continents
once joined)
Transitional Fossils
• Archaeopteryx fossils: multiple specimen
found in limestone in Germany
Archaeopteryx: Berlin specimen
Archaeopteryx: Eichstatt specimen
Archaeopteryx: Solnhofen specimen
Whale Evolution
• Video about the transitional forms in the
evolution of whales – mammals evolving
from land back to sea
• http://www.pbs.org/wgbh/evolution/library/
03/4/l_034_05.html
“Genetic Tool Kit”
• Video about Homeobox genes and
implications for evolution:
• http://www.pbs.org/wgbh/evolution/library/
03/4/l_034_04.html
• Answer the questions on your handout
Eye Evolution
• Video about the evolution of the eye:
• http://www.pbs.org/wgbh/evolution/library/
01/1/l_011_01.html
• Answer the questions on your handout