Transcript Genomes & their evolution

GENOMES & THEIR
EVOLUTION
Campbell & Reece Chapter 21
Genomics


study of a specie’s whole set of genes &
their interactions
bioinformatics: use of computers,
software, & mathematical modes to
process & integrate biological
informationfrom large data sets
Human Genome Project



sequencing the human genome
1990 – 2003
20 large centers in 6 countries + many
other small labs working on small parts
of it
FISH
Cytogenetic Map: chromosome banding
pattern & location of specific genes by
flourescence in situ hybridization
(FISH)
 b/4 Human Genome Project the # of
chromosomes & their banding patterns
known for many species
 some human genes already located
FISH


method in which flourescently labeled
nucleic acid probes allowed to
hybridize to immobilized array of
whole chromosomes
maps generated from this used as
starting point
3 Stages
to Genome Sequencing
1.
2.
3.
Linkage Mapping
Physical Mapping
DNA Sequencing
Linkage Mapping

ordering of genetic markers (1000’s)
spaced thru-out chromosomes
 order
& spacing determined by
recombinant frequencies
 markers: genes, RFLPs, (restriction
fragment length polymorphism) or STRs
(short tandem repeats)
RFLP

in gel electrophoresis, fragments of
DNA are separated by length
 (-)
charge of phosphate groups moves DNA
thru gel (acting like a sieve) toward (+)
end

resulting in: bands that each consist of
thousands of DNA molecules of same
length
RFLP


1 useful technique has been to apply
restriction fragment analysis to these
bands  information about DNA
sequences
restriction enzymes “cut” DNA at
known nucleotide sequences then
these fragments produced are put thru
gel electrophoresis
RFLP


DNA can be recovered undamaged from
gel bands (so can be used to prepare
pure sample of individual fragments)
can be used to compare 2 different
DNA molecules (2 alleles of same gene)
if nucleotide sequence affects a
restriction site: change in even 1
nucleotide will prevent the “cut”
RFLP



(restriction fragment length polymorphism)
polymorphisms: variations in DNA
sequence among a population
this particular type of sequence change
is called RFLP (“rif-lip”)
if 1 allele contains a RFLP, digestion
with the enzyme will produce a
fragment of different length
Short Tandem Repeats: STR




technique used by forensic scientists
are tandemly repeated units of 2 to 5
base sequences in specific regions of
the genome
# repeats present is highly variable
person to person (polymorphic)
1 individual’s may vary if has 2 alleles
STR



PCR (polymerase chain react is used to
amplify particular STRs
quicker technique than RFLP analysis
can be used with less pure samples of
DNA or if only have minute sample
PCR
3 Stages
to Genome Sequencing
1.
2.
3.
Linkage Mapping
Physical Mapping
DNA Sequencing
Physical Mapping



ordering of large fragments cloned in
YAC & BAC vectors
followed by ordering of smaller
fragments cloned in phage & plasmid
vectors
key is to make overlapping fragments
& then use probes or automated
nucleotide sequencing of ends to find
the overlaps
YAC & BAC
Yeast Artificial
Chromosome


1st cloning vector
carries inserted
fragments
million base
pairs (bp) long
Bacterial Artificial
Chromosome

carries inserts of
100,000 –
300,000 bp
Physical Mapping



fragments from YAC & BAC put in
order
each fragment cut into smaller pieces
which are then cloned in plasmids,
ordered, & finally sequenced
DNA Sequencing



determination of nucleotide sequence
of each small fragment & assembly of
the partial sequences into the
complete genome sequence
for human genome used sequence
machines
sequencing of all 3 billion bps in
haploid set of human chromosomes
done at rate 1,000 bp/s
Human Genome Project


took 13 yrs
$100 million
Sequencing an Entire
Genome
Whole-Genome
Shotgun Approach


essentially skips the linkage mapping
& physical mapping stages & starts
with sequencing of DNA fragments
from randomly cut DNA
computers then assemble the resulting
very large # of short sequences into a
single continuous sequence
Shotgun Approach
Application of Systems
Biology to Medicine

2007 – 2010 set out to find all the
common mutations in 3 types of
cancer (lung, ovarian, glioblastoma) by
comparing gene sequences & patterns
of gene expression in cancer cells
compared to normal cells
Cancer Genes



# genes identified that had been
suspect + genes that were not
suspected
gives researchers point to develop new
treatments aimed specifically @ these
genes
10 more cancers then studied (most
common/most lethal)
Microarray Chip
Genomes Vary in Size, # of
Genes, & Gene Density
# of Genes



Prokaryotic cells < Eukaryotic cells
Humans: expected 50,000 – 100,000
but have found < 30,000
How do we get by with not many more
genes than nematodes?
#
proteins we have > # genes
 vertebrates use alternative splicing of
RNA transcripts
Gene Density




# genes in given length of DNA
eukaryotes generally have larger
genomes but fewer genes in given # of
bps
humans have 100’s – 1000’s times
more bps but only 5 – 15 times as
many genes
Sooooo: gene density lower in humans
than in bacteria
Noncoding DNA

includes most of eukaryotic DNA
 introns
 most
is noncoding DNA between genes

1.5% of our
genome codes for
proteins, or is
transcribed into
rRNA or tRNA
Pseudogenes

former genes that have accumulated
over a long time & no longer produce
functional proteins
Repetitive DNA


sequences that are present in multiple
copies in the genome
75% of this repetitive DNA (44% of
entire genome) is made up of units
called transposable elements & related
sequences
Transposable Elements &
Related Sequences



found in both prokaryotes &
eukaryotes
stretches of DNA that can move from
one location to another w/in the
genome
transposition: process where 1
transposable element moves from 1
site to different target site by a type of
recombination process
“Jumping” Genes
Transposons



Gene that is “jumping” never actually
completely detach from the cell’s DNA
original and new strands brought
together by enzymes & other proteins
that bind to DNA
1st evidence came from studying
genetics of Indian corn
Movement of Transposons &
Retrotransposons
2 types of eukaryotic transposons:
1. Transposons




move w/in genome by means of DNA
intermediate
move & paste or cut & paste
both require enzyme transposase
(encoded by transposon)
Retrotransposon




2nd type of eukaryotic transposable
element
move by means of RNA intermediate
that is a transcript of retrotransposon
DNA
always leave copy @ original site during
transposition
RNA intermediate is converted back to
DNA by reverse transcriptase (enzyme
encoded by retrotransposon)
Other Repeating DNA


probably arises due to mistakes made
during DNA replication or
recombination
~14% human DNA
 ~1/3
of this duplications of long stretches
of DNA
 segments copied from 1 chromosomal
location to another on same or different
chromosome
Simple Sequence DNA

Contains many copies of tandemly
repeated short sequences:
 ATTGCGATTGCGATTGCGATTGCG
 repeated
units can be 2 – 500 nucleotides
Short Tandem Repeat (STR)




repeating units that are 2 to 5
nucleotides long
found on telomeres & centromeres (so
may play structural role)
# of repeating units can vary w/in
same genome and with different alleles
this diversity means STR’s can be used
in preparing genetic profiles
Other Types of DNA


1.5% of genome: genes that code for
proteins, rRNA, tRNA
include introns & regulatory sequences
associated with genes total amt is 25%
of the human genome
Multigene Families



<1/2 genes present in 1 copy
multigene families: collections of 2 or
more identical or very similar genes
some identical present in tandem,
repeats code for an RNA or histone
proteins
rRNA genes


repeated tandemly 100’s to 1000’s
times in 1 to several clusters in
genomes of multicellular eukaryotes
helps cells quickly make millions of
ribosomes necessary for protein
synthesis
Multigene Families of
Nonidentical Genes




Globins: group of proteins that include
the α and β polypeptide subunits of hgb
Chromosome 16 encodes for forms of
α-globin
Chromosome 11, encodes for β-globin
different forms are expressed @
different times in development
allowing hgb to function effectively in
changing environment of developing
animal
Fetal-Globin

in fetal stage use this globin because it
had higher affinity for O2 ensuring the
efficient transfer of O2 from mother
Clues to Evolution


by looking at arrangement of genes in
gene families get insight into evolution
of genomes
genome w/4gene families in 4 species
Genome Evolution

“accidents” in cell division can lead to
extra copies of all or parts of a
chromosome which can then diverge if
1 set accumulates nucleotide sequence
changes
Genome Evolution


compare chromosomal organization of
genomes among species  info about
evolutionary relationships
w/in given species rearrangements of
genes thought to contribute to
emergence of new species
Globin Gene



1 common ancestral globin gene 
duplicated & diverged into α and β
globin ancestral genes
subsequent duplication & random
mutation  present day globin genes
all genes along the way code for O2 binding proteins
Globin Genes

some copies of the duplicated globin
genes have diverged so much that their
functions are now substantially
different
 examples:
 lysozyme:
enzyme that destroys bacterial
cell walls in mammals, found in sweat,
tears, & saliva
 α-lactalbumin: protein found in milk,
contains all a.a.
Gene Evolution

rearrangement of exons w/in &
between genes during evolution 
genes containing multiple copies of
similar exons&/or several different
exons derived from other genes
Gene Evolution


movement of transposable elements or
recombination between copies of same
element occasionally creates new
sequence combinations that are
beneficial to the organism
new combinations can alter function of
genes or their patterns of expression &
regulation
Comparing Genome
Sequences


human & chimpanzee sequences show
~4% differences
most due to:
 insertions
 deletions

duplications
4%
FOXP2 Gene


gene that affects speech
human & chimp have nucleotide
sequence variations
SNPs & CNVs



Single Nucleotide Polymorphisms
Copy Number Variations
variations of both w/in a species can
yield information about the evolution
of that species
Evo-Devo Biologists

Evolutionary Developmental biologists
have show that homeotic genes (any of
the master regulatory genes that control
placement & spatial organization of body parts
in animals) & other genes associated with

animal development contain a:
 homeobox region
has sequence that is highly conserved
among diverse species (animals, plants,
yeast)
Homeobox Genes in Fruit Fly
& Mouse
Hox Genes




genes or groups of genes that are
responsible for the lay out of basic
body forms
set up the head-to-tail organization
are general purpose (work in many
animal phylums)
small changes in them or the genes
that control them would lead to major
source of evolutionary change
Changes in Expression of Hox
Genes have changed over
evolutionary time
Comparisons of Animal &
Plant Development


last common ancestor of plants &
animals probably a unicellular
eukaryote (100s of millions of years
ago)
morphogenesis in plants relies on
differing planes of cell division & on
selective cell enlargement
Comparing Development in
Plants & Animals



development relies on a cascade of
transcriptional regulators turning
genes on/off
Plants do not use Hox genes, they have
another group of genes (Mads-box)
can find Hox genes in plants & Madsbox genes in animals but in neither
case do they have same major role in
development