Transcript PCR

Analyzing the PTC Taster
Gene (tas2r38) through
PCR Amplification
The human taste process
*Food is recognized by a taste receptor where the
protein binds to the receptor most closely related
to the 5 tastes: Sweet, Bitter, Sour, Salty, and
Umami
*The shapes of the protein closely matches the
shape of the related receptor.
*The receptor sends a nerve impulse to your brain
which interprets it as one of those tastes.
*The receptors, neuron messages and
interpretation are all determined by your genetics,
though can be altered by environment or injury.
The human taste process
Bitter Tasting Chemical PTC
(
)
*Arther Fox in the late 20’s was using this chemical
in a lab at Du Pont.
*His collegue complained that he could taste the
chemical in the air, but Fox was not experiencing
the same taste sensation.
*This was tested with many co-workers and friends
and genetics was thought to play a role.
*It is said that paternity was even tested by this early
on.
Bitter Tasting Chemical PTC
*Albert Blakeslee, in 1932,
determined that the ability to taste
this chemical must be a dominant
trait when most test subjects could
taste the chemical.*
*In 2004, the gene responsible was located on
chromosome 7. We get one allele from our mother
and one from our father.
The gene is called TAST2R38
*The gene is just over 1000bp in length
*There are three areas of variance that causes the
taster/nontaster forms or 3 SNPS-Single Nucleotide
polymorphism.
Postition
Taster
Nontaster
145
C (proline)
G (alanine)
785
C (alanine)
T (valine)
886
G (valine)
A (isoleucine)
In this lab, you will:
*Extract your own DNA using Chelex
*Use Polymerase Chain Reaction (PCR)
to amplify a portion of your own TAS2R38
gene
*Use a restriction enzyme to potentially
cut your TAS2R38 genes
*Use gel electrophoresis to separate any
fragments produced by the restriction
enzyme activity
Amplifying TAST2R38 with PCR
*Primers used in the experiment:
CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG
AGGTTGGCTTGGTTTGCAATCATC
Amplified Region is 221 bp with the 145 position SNP
Predicting Alleles and Trait
*If PCR was done correctly, everyone will have a
very large amount of 221 bp PCR product
*To predict the alleles, you have to separate the
dominant from recessive
*This is where the 145 SNP comes in
Predicting Alleles and Trait
*Using HAEiii enzyme, a restriction digest can
be
done at this SNP
*HAEiii restriction site is GGCC
• The pcr product that has GGCC will be cut into two
pieces
• The pcr product that has GGGC will not cut
• Those that are heterozygous will have a mixture of
both. Some product with GGCC and some product
with GGGC
RDigest of PCR Product
PCR PRODUCT = 221 BP length
145 SNP
...GGCGGGCACT...
... CCGCCCGTGA...
...GGCGGCCACT...
...CCGCCGGTGA...
Non-taster allele
taster allele
Add HAEiii for RD
...GGCGG
...CCGCC
CCACT...
GGTGA...
2 pieces
44bp
177 bp
...GGCGGGCACT...
...CCGCCCGTGA...
1 piece
221 bp
Visualization of DNA results
using gel electrophoresis
tt
U
D
Non-Taster
TT
U
D
Taster
Tt
U
D
M
Taster Hetero
Day 1: Isolating your DNA
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
Label two microtubes and cup of saline solution with your identity
number given to you by your teacher.
Pour saline solution in your mouth and vigorously rinse your
cheeks for 1 minute.
Expel solution back into cup.
Carefully, over garbage or sink pour spit into your microtube.
Close tube tightly and put into spectrafuge (high powered). It will
spin for 5 minutes.
Look for cell pellet. Carefully pour of supernatant into waste and
keep cell pellet in tube.
Pipette 250 ul of 10% chelex into your microtube and resuspend
cell pellet by vortexing or mixing solution up and down in pipette.
Once resuspended fully, close lid tightly and poke a hole using a
tack into the top of the lid.
Place into 99o hot block for 10 minutes.
Resuspend solution one more time and then spin in a
minicentrifuge for 30 seconds so the Chelex beads fall to bottom of
tube.
Without disturbing the beads at the bottom, pipette about 50 ul of
solution into second tube.
This is your extracted DNA. Your teacher will freeze your tube for next
class.
Day 2: Performing PCR
1. PCR tubes should be on ice. Label PCR tube with your identity number then put
back on ice.
2. Obtain your DNA tube from your teacher and carefully thaw it on countertop.
3. Pipette 5 ul of your DNA into your PCR tube.
4. Come up to front of room with your 20 ul pipette set at 20 ul and a fresh tip.
Pipette 20 ul of master mix from the teachers stock
5. Return to your seat and quickly vortex pcr tube, then spin it down in
minicentrifuge.
6. Bring it to the pcr machine, put on ice if teacher is waiting for other student tubes
or put directly in PCR machine.
7. Your teacher will run the program, once all tubes are finished.
** Hint: Work carefully and quickly to get this done.
The master mix is time sensitive.
Day 3: Restriction Digest of PCR Product
1. Label two 1.5 ml microtube with your number and one with “U” for Undigested
and one with “D” for digested.
2. Obtain your PCR product.
3. Pipette 10ul of PCR product into “U” tube.
4. Pipette 12ul of PCR product into your “D” tube.
5. With new tip, pipette 2ul of HAEIII enzyme into your “D” Tube.
6. Mix by tapping tube, give it a quick spin down in microcentrifuge and put into
waterbath at 37o for 1 hour.
7. Bring your “U” tube to the front and your teacher will pull your “D” tube and put
both into the refrigerator for tomorrow.
Day 4: Running your PCR Products “U” and “D” on a 2% PCR Gel
1.
Obtain your “U” and “D” tube.
2.
Set up your electrophoresis box with 1x TAE gel and a 2% PCR gel.
3.
Label two new microtubes with “U” and “D”
4.
Pipette 2ul of loading dye into your new “U” tube and “D” tube.
5.
Pipette 10 ul sample from your original “U” into your new “U” tube.
6.
Pipette 10 ul of sample from your original “D” tube into your new
“D” tube.
7.
Add 3 ul of dH2O to each one of the new tubes.
8.
Load 10ul of PCR Marker into the first lane of gel.
9.
Load 12 ul of “U” tube into next open lane.
10. Load 12 ul of “D” tube into next open lane.
11. Record which lanes your samples are in.
12. When all lanes are loaded, close the electrophoresis box and run
gel at 75V for 35-40 minutes.
13. Carefully remove your gel from box when finished running and
take a picture of your gel using the UV camera.
14. Analyze your results.