Transcript Differential Sperm Cell Gene Expression in Plumbago

Introduction
Double fertilization in flowering plants involves two sperm cells:
one fuses with the egg cell to form the zygote, whereas the other fuses
with the central cell to form the endosperm. Plumbago zeylanica is a
model system in which it is possible to identify the sperm cells. One
sperm cell (Svn) is associated with the pollen vegetative nucleus, and the
other unassociated sperm cell (Sua) is linked with the Svn. Functionally,
the Sua fuses with the egg preferentially over 95% of the time1. The
molecular control of this phenomenon is unknown, as gene expression in
flowering sperm cells is still in its infancy. The first ESTs of genes
expressed in sperm cells were released in GenBank in 2000 by Fang
Chen’s laboratory and in 2002 by Sheila McCormick’s laboratory.
Sperm-specific expression of GFP has recently been demonstrated
(http://www.pgec.usda.gov/McCormick/McCormick/mclab.html)
in
Arabidopsis. The greatest success thus far has been obtained using
generative cells, which are the immediate precursors to sperm cells.
Work on cells of the male germ linage was impeded by problems in
obtaining sufficient sperm cells to conduct molecular biology and in
maintaining their purity during isolation from the pollen2. At that time,
the accepted paradigm was that the male cells were too small and
dependent to have an independent genetic program, but once protein,
RNA and DNA synthesis were demonstrated in sperm3 and generative
cells4, work on molecular biology began. Since then, male gamete
expression of DNA repair genes5, substitution histones6, and essential
sperm specific gene products7 have been demonstrated. The male
gametic-specific expressed gene LGC1, isolated from lily generative
cells7, is expressed in both generative and sperm cells, its gene product
is distributed on the generative cell surface, and its expression is
controlled by a sperm specific promoter.
We are interested in the control of structural/functional sperm
dimorphism, as expressed in Plumbago zeylanica, in which the pair of
sperm cells undergo a developmental divergence in their organization
and gene expression during pollen maturation, which affects their fate
during fertilization. The divergence in sperm cells is marked by
structural polarization, which is related to the position of the pollen
vegetative nucleus and demonstrated most easily by differences in
organelle content. The Svn typically contains many mitochondria and
few or no plastids, whereas the Sua contains few mitochondria and
abundant plastids; the latter usually fusing with the egg cell1. We are
interested in how the differential fate of these two sperm cells is
controlled. Recent research has shown that a male germ line-specific
ubiquitin gene is highly up-regulated in both lily generative cells and in
the Svn sperm cell of Plumbago8. In this study, we are interested in genes
that are exclusively expressed or up-regulated in only one of the two
sperm cells of Plumbago, especially genes involved in gamete cell
recognition. Here we report preliminary results obtained by combining
suppression subtractive hybridization and microarray analysis.
Materials and methods
Sperm cell isolation
Sua and Svn sperm cells were isolated and collected in separate pools using a
microinjector, as described in Zhang et al.9 Purified sperm cells were stored in liquid
nitrogen until use. About 12,000 sperm cells were collected for each cDNA library and
subtracted cDNA library.
RNA isolation
Total RNA of sperm cells was isolated by using Absolutely RNATM microprep kit
(Stratagene) and precipitated by glycogen and ethanol. The RNA pellet was dissolved
in 3 µl RNase-free water and immediately used for cDNA synthesis.
cDNA library construction
cDNA libraries were constructed using the Smart cDNA library construction kit
(Clontech) according to the user manual.
Suppression subtractive hybridization
Double stranded cDNAs of Sua and Svn were synthesized using Smart PCR cDNA
Synthesis kit (Clontech). Subtracted cDNA libraries were constructed using the PCRSelect cDNA Subtraction kit (Clontech). Subtracted cDNAs were purified and cloned
into pCR2.1-TOPO vector (Invitrogen).
Microarray experiments
Clones of subtracted cDNA libraries were selected randomly and their inserts were
PCR amplified. PCR products were purified by ethanol precipitation and dissolved in
50% DMSO. DNA samples were spotted onto CMT-GAPS coated glass slides
(Corning) and air dried. Air-dried slides were rehydrated over boiling water and dried
again on a 90℃ heating plate. Then slides were crosslinked in Stratagene Stratalinker
UV Crosslinker. Slides were prehybridized for 1 hr and hybridized for 16 hr at 42℃ in
hybridization chambers. Subtracted and unsubtracted cDNA of sperm cells were
labeled by Cy3 and Cy5 dye (Amersham Phamacia). After washing, the signal was
detected by Axon GenePix 4000A microarray scanner.
Virtual Northern hybridization
cDNA of sperm cells was synthesized by the Smart PCR cDNA synthesis kit. 0.5 µg
dscDNA of Sua and Svn was separated respectively on 1% agarose gel and transferred to
nylon membrane. Inserts of interesting clones were labeled by digoxigenin.
Hybridization and signal detection were carried out according to the Roche nonradioactivity detection manual (Roche Applied Science).
RT-PCR
Equal amounts of cDNA of Sua and Svn were used for the RT-PCR reaction. The
number of cycles was varied to demonstrate differential expression levels.
Differential Sperm Cell Gene Expression in Plumbago
Xiaoping Gou1, Tong Yuan1, Mohan B. Singh2, Scott D. Russell1
1Department
of Botany and Microbiology, University of Oklahoma, Norman, OK 73019 USA
2Plant Molecular & Biotechnology Center, University of Melbourne, Parkville, Victoria 3052, AUSTRALIA
Abstract
Mature pollen of Plumbago zeylanica contain dimorphic sperm cells of two types: Sua and Svn. These cells contain different organelle complements and fuse
with different female target cells, the Sua fusing with the egg cell and the Svn fusing with the central cell, respectively. To discriminate between genes active in
each cell, we constructed subtracted cDNA libraries to each of these two kinds of sperm cells for microarray screening. PCR amplified products were cloned
into pCR2.1-TOPO vector. The inserts were PCR amplified and spotted onto glass slides for microarray screening. 2304 clones of each subtracted cDNA library
were examined using subtracted and unsubtracted cDNA probes. Subtractive hybridization made it easier to identify those genes expressed differentially in these
two kinds of sperm cells. Several hundred clones that have different expression level in a pair of sperm cells have been identified. The expression pattern of
seven clones has been verified by virtual northern hybridization and (or) RT-PCR. One of them, clone A7, which is homologous with arabinogalactan protein in
Arabidopsis, has a signal peptide sequence and a transmembrane domain. It may play a role in cell recognition.
RT-PCR. Three clones, A7, A12 and C8, were selected for RT-PCR
detection. Different cycles were used. A7 expression can be detected at 18
cycles in the Sua, but at least 24 cycles are required in the Svn (Fig. 6). The
A7 gene has a higher expression level in the Sua. The full-length cDNA of
A7 was isolated by screening Sua cDNA library (Fig. 5). Sequencing
showed that A7 codes a protein with 63 amino acids which is homologous
to members of an arabinogalactan protein family in Arabidopsis (Fig. 7).
This protein has a signal peptide and a transmembrane domain. Although
the precise function of this gene family is unknown, they may play
important roles in diverse developmental processes such as differentiation,
cell-cell recognition, embryogenesis and programmed cell death15.
Fig. 6. RT-PCR detection of A7, A12, C8 in Sua and Svn.
Different cycles are showed on the top of the gel. H3.3 is a
highly expressed control.
Results
cDNA synthesis of sperm cells. Because sperm cells are small and
embedded in pollen, only limited quantities of sperm cells are available for
this research. Therefore, mRNA needs to be reverse transcribed and PCR
amplified. To assure that cDNA libraries are representative, PCR reactions
need to be controlled carefully. For cDNA library construction, 11,428 Sua
sperm cells and 11,073 Svn sperm cells were used. The corresponding PCR
cycles were optimized at 24 and 26 cycles, respectively. For subtractive
hybridization, 12,200 Sua sperm cells and 12,245 Svn sperm cells were
used. The corresponding PCR cycles were optimized at 20 cycles (Fig. 1).
Fig. 3. Microarray. Inserts
of suppression subtractive
hybridization clones were
PCR amplified and spotted
on glass slides. In each
block, clones in the top
four rows are putative Suaexpressed genes; the next
four rows are putative Svnexpressed genes. The left
slide was hybridized with
subtracted probes; the right
slide was hybridized with
unsubtracted probes. The
Sua probe was labeled with
Cy3 (green), whereas the
Svn probe was labeled with
Cy5 (red).
 Fig. 1. Different cycles were used to optimize the PCR
reaction of ds-cDNA synthesis of Sua. M, Molecular standards. 1,
18 cycles. 2, 21 cycles. 3, 24 cycles. 4, 27 cycles. 5, 30 cycles. 6,
33 cycles. 24 cycles were used in this reaction.
Fig. 2. Inserts of randomly selected clones of subtracted cDNA
libraries were PCR amplified and separated on 1% agarose gel. 
Suppression subtractive hybridization. Subtractive hybridization is a
powerful technique for comparing mRNA populations and selecting
differentially expressed genes. Traditional subtractive methods are not
suitable, as the amount of available mRNA is limited for flowering plant
sperm cells. Therefore, the Clontech PCR-Select cDNA subtraction
method was used to amplify differentially expressed sequences10. Sua- and
Svn-specific expressed sequences were obtained by using subtractive
hybridization, with one sperm cell source as ‘tester’ and the other as
‘driver’. In cases where different cell sources have strongly overlapping
gene expression or where few mRNA species differ, this technique may
produce significant numbers of false positives. The Sua and Svn, as cellular
siblings, are thus likely candidates for additional screening. Microarray
screening of cell products is an ideal screen prior to time-consuming
northern hybridization.
Table 1. Number of up-regulated expression clones using different probes
Unsubtracted probes
Subtracted probes
Number of up-regulated expression
clones in Sua (Ratio of means>3)
102
1004
Number of up-regulated expression
clones in Svn (Ratio of means>3)
1071
1236
Virtual northern hybridization. To confirm expression specificity, six
Sua-specific candidates and one Svn-specific candidate were selected and
digoxigenin labeled. Labeled probes were hybridized with 0.5 µg Sua and
Svn cDNA. All of them were confirmed as Sua- or Svn-specifically expressed
genes. Four clones (A1, A12, B9, F4) have more than 1 gene family
member. These clones were sequenced and compared with the data in
GenBank by BlastX. The results are summarized in Table 2.
Fig. 7. A7, named as PzAGP, is homologous with putative Arabidopsis arabinogalactan
proteins AtAGP16 and AtAGP20.
Conclusions
These results clearly indicate the feasibility of using microarray analysis
and suppression subtractive hybridization to screen candidates for Sua- and
Svn-specific gene expression patterns. Although sufficient mRNA is not
available for traditional testing, use of PCR amplification seems to be
adequate for presence/absence screening. In the future, we are interested in
sperm cell differentiation and gamete cell-cell recognition. We plan to
confirm the expression profiles of Sua- or Svn-specific expressed genes by
RT-PCR, virtual northern hybridization and in situ hybridization.
Following this characterization, we plan to search for corresponding genes
in Arabidopsis that may be useful for sperm cell labeling and tracing the
double fertilization process. Sequence data will be used to identify putative
surface-localized proteins that may mediate sperm-egg interactions. This
work will serve as the basis of future research on the control of gene
expression that establishes the identity of sperm cell types.
Acknowledgements
We thank Drs. Bruce A. Roe, Tyrrell Conway, Jia Li, Doris M Kupfer and
Mary Beth Langer for their kind help. This research was supported by
USDA NRICGP grant #99-35304-8097, GLC Research Professorship
funds from the University of Oklahoma and private donations.
References
1.
2.
3.
Microarray screening. After subtractive hybridization, PCR products
were purified and cloned into pCR2.1-TOPO vector by T/A cloning and
transformed into TOP10F’ competent cells. Inserts of recombinants were
amplified by PCR. Most of the recombinants had inserts whose size
ranged from 200 bp to 1.5 kb (Fig. 2). A total of 4,608 clones were
selected for the following microarray analysis. Clones corresponding to
differentially expressed genes will hybridize only with the tester probe.
But it will be difficult to detect low-abundance differentially expressed
mRNAs by traditional subtractive hybridization11,12. This problem can be
bypassed by using subtracted cDNA probes to hybridize with the
subtracted libraries. In this work, subtracted probes were synthesized by
using Sua and Svn as tester or driver respectively. Since insufficient mRNA
was available, probe was reverse transcribed, PCR-enhanced and labeled
using Cy3 or Cy5.
Combining suppression subtractive hybridization and microarray analysis
techniques facilitates high throughput screening for differentially expressed genes in sperm cells of Plumbago. Most of the clones of subtracted
cDNA libraries represent differentially expressed Sua or Svn genes (Fig. 3).
When hybridized with subtracted probes, the signal is stronger than that of
unsubtracted probes and some low abundance, differentially expressed
sequences can be detected13,14. After analysis by GenePix Pro 3.0, those
clones with more than a 3-fold expression difference between the Sua and
Svn can be identified easily with unsubtracted probes. Usually these clones
represent abundant Sua or Svn specific genes. Hybridization with subtracted
probes will help us to identify those low-abundance and rare messages
expressed in Sua or Svn (Table 1).
4.
5.
6.
Fig. 4. 0.5 µg SMART PCR amplified cDNA of Sua and Svn were separated on 1% agarose
gel and transferred to nylon membrane. The blot was hybridized with DIG-labeled probes.
7.
8.
9.
Table 2. Differentially expressed clones.
Clone
A1
A12
A7
B9
C8
D9
F4
Sequence identity
ATP synthase epsilon subunit [Phyllonoma ruscifolia]
homocysteine S-methyltransferase-4 [Zea mays]
arabinogalactan-protein (AGP20) [Arabidopsis thaliana]
ATP-dependent Clp protease proteolytic subunit [Nicotiana tabacum]
putative DNA-directed RNA polymerase II subunit [Arabidopsis thaliana]
hypothetical protein [Arabidopsis thaliana]
Hypothetical ORF [Saccharomyces cerevisiae]
mRNA size (Kb)
NA
NA
0.83
NA
0.85
0.95
NA
ACGCCGCCCGTTGACTACTCGTTTCTATCACGCGCTTCCTACCTCCTTCCTCTTTCTTCTTCTTCTTTTTTTTTTCTTTTTTTTCCTGAATGCTTCCTTAGAAATTTCACTGGAGAATCT 121
TCCCCCACTTAATAGTTGAATCGTATATATACGCGTTAGAGAAAGATTTTCTATCGCAAACAATCAAGCCATTCGTACACAGAGTCCTTAATTATTCCACCTCTCTTCCTTTAAATTTCC 241
10.
11.
12.
13.
TCTAATTACTCAGCTTGAGGCAGTTTATTGAGGCACGTCGGCAGGTCGCATCTCTTTCTGAAATACTAATCGTTTGATATAATATTTGACTTCATTCAATTAGGAGATATGGCGAGATCG 361
M
A
R
S
CACGTTCTTCCAATGATTGGGTTCCTGTTCATGGTTATTTTCCGAGTTTGCTCCGGTCAGATCGCTCCTTCTCCGACGGCGGAAGTCCCAGCGTCAAGCGACGGCACTGCAATTGACCAA 481
H
V
L
P
M
I
G
F
L
F
M
V
I
F
R
V
C
S
G
Q
I
A
P
S
P
T
A
E
V
P
A
S
S
D
G
T
A
I
D
Q
GGAATCGCTTACCTGTTGCTTCTGCTCGCTCTCGCCATCACTTACACCTTCCACTGGTAGCAATCTTTTTTCCTATCACTTCCTATTATATCGCTGAAACCGAATGCGGAATAGAAGAAG 601
G
I
A
Y
L
L
L
L
L
A
L
A
I
T
Y
T
F
H
W
14.
*
AATATCTATCGATTGTAGAGAGATTTGAGGGTTCGAAATGATTTGTATCTCCCAGCCCAATTCTTTTTAGATTAGAAACCCCCATTTTTTTAATTAATAAATAAATATAAATGTACTGAG 721
ATTTATTTCATTTTTCTTACGAATCTACTGTTACCGTGTAATTTAAATAAGATAGGGCAATTCTTGTGTTTATAAACGACGTTGGTACTTCTCCCATAAAAAAAAAAAAAAAAAAAAAAA 841
AAAAAAA
848
Fig. 5. Full-length cDNA sequence of Clone A7. It codes a protein with 63 amino acids.
15.
Russell, SD. 1985. Preferential fertilization in Plumbago: ultrastructural evidence for
gamete-level recognition in an angiosperm. Proc Natl Acad Sci USA, 82:6129-6132
Russell, SD. 1986. A method for the isolation of sperm cells in Plumbago zeylanica. Plant
Physiology, 81: 317-319
Zhang G, Gifford DJ, Cass DD. 1993. RNA and protein synthesis in sperm cells from Zea
mays L. pollen. Sex Plant Reprod 6: 239-243
Blomstedt CK, Knox RB, Singh MB (1996) Generative cells of Lilium longiflorum
possess translatable mRNA and functional protein synthesis machinery. Plant Mol Biol
31:1083-1086
Xu H, Swoboda I, Bhalla PL, Sijbers AM, Zhao C, Ong EK, Hoeijmakers JH, Singh MB
(1998) Plant homologue of human excision repair gene ERCC1 points to conservation of
DNA repair mechanisms. Plant J 13:823-829
Xu H, Swoboda I, Bhalla PL, Singh MB. 1999a. Male gametic cell-specific expression of
H2A and H3 histone genes. Plant Mol. Biol. 39:607–614
Xu H, Swoboda I, Bhalla P L, and Singh M B. 1999b. Male gametic cell-specific gene
expression in flowering plants. Proc Natl Acad Sci USA, 96: 2554-2558
Singh MB, Xu H, Bhalla P, Zhang Z, Swoboda I, Russell SD. 2002. Developmental
expression of polyubiquitin genes and distribution of ubiquitinated proteins in generative
and sperm cells. Sexual Plant Reproduction 14: 325-329
Zhang Z, Xu H, Singh MB, Russell SD. 1998. Isolation and collection of two populations
of viable sperm cells from the pollen of P. zeylanica. Zygote 6: 295-298
Diatchenko L, Lau YFC, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S,
Lukyanov K, Gurskaya N, Sverdlov ED & Siebert PD. 1996. Suppression subtractive
hybridization: A method for generating differentially regulated or tissue-specific cDNA
probes and libraries. Proc. Natl. Acad. Sci. USA 93:6025-6030
Duguid JR & Dinauer MC 1990. Library subtraction of in vitro cDNA libraries to identify
differentially expressed genes in scrapie infection. Nucl Acid Res 18:2789–2792
Hara E, Kato T, Nakada S, Sekiya S & Oda K (1991) Subtractive cDNA cloning using
oligo(dT)30-latex and PCR: isolation of cDNA clones specific to undifferentiated human
embryonal carcinoma cells. Nucleic Acids Res. 19:7097–7104
Welford SM, Gregg J, Chen E, Garrison D, Sorensen PH, Denny CT, and Nelson SF.
1998. Detection of differentially expressed genes in primary tumor tissues using
representational differences analysis coupled to microarray hybridization
Nucleic Acids Res 26: 3059-3065
Yang GP, Ross DT, Kuang WW, Brown PO, and Weigel RJ. 1999. Combining SSH and
cDNA microarrays for rapid identification of differentially expressed genes.
Nucleic Acids Res 27: 1517-1523
Gaspar Y., Johnson K., McKenna J., Bacic A, Schultz C. 2001. The complex structures of
arabinogalactan-proteins and the journey towards understanding function. Plant Mol Biol
47: 161-176