Transcript Ch 26 systematics phylogeny S

Ch. 26 Phylogeny
and the Tree of Life
Opening Discussion:

Is this basic “tree of life”
a fact? If so, why? If not,
what is it?

Appreciate the enormous diversity and
complexity of life on Earth.
There are 1.8
million named
species....
…a fraction of the 10 – 100
million extant species.
Phylogeny =
the evolutionary
history of a
species or group
of species
 Taxon = named
taxonomic unit
at any level of
the hierarchy

Write down the
hierarchical
classification system:
What is the binomial
nomenclature?
What goes into phylogeny?

Systematics data

Homologies: similarities due to shared ancestry
Linnaeus, 1707- 1778
Phylogenetic trees

Clade = a group of species that includes an
ancestral species and all of its descendants
◦ Monophyletic Group
Monophyletic vs
Polyphyletic & Paraphyletic
Phylogenetic trees
Node
 Sister taxa

Shared ancestral trait
 Shared derived trait

A
B
What are the:
Shared
Ancestral
Traits?
Shared
Derived
Traits?
C
D
How to tell how to make the tree?
Parsimony = logical principle that the
most likely explanation is the one that
implies the least amount of change
 (Simplest answer is most likely true)

Genetic & Molecular homologies
Biotechnology
revolution of late
20th century has
given us new type
of homology
 Universal code:
All lifeforms share
certain molecular
traits

e.g., similarities in
hemoglobin molecule
Actual sequence of nucleotides for the "leptin" gene for
Mouse, Chimpanzee and Human:
First 60 nucleotides:
M gaggga tcc ctgctccagc agctgcaagg taaggcccggggcgcgctact ttctcctcca
C gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct
H gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct
Nucelotides 121-180:
C: agtcaggagg gaggcagggc ggatggctta gttctggact atgatagctt tgtaccgagt
H: agtcaggagg gatgcagggc ggatggctta gttctggact atgatagctt tgtaccgagt
(National Center for Biotechnology Information)
Evidence from Molecular Biology
When confirm
previous
conclusions -COHERENCE
 Can use
molecular
homologies when
other approaches
not possible

e.g., similarities in cytochrome c protein
How to tell how to make the tree?

Which tree(s) is/are parsimonious and
likely?
◦ Maximum Parsimony
◦ Maximum Likelihood
Homology vs Homoplasy
Convergent evolution:
Adaptation by members
of different lineages to
similar environment
 Homoplasy = similar
analogous structures that
arose independently,
without shared ancestry

Ocotillo (NA)
Allaudia (Madagascar)
Figure 25.10 Convergent evolution and analogous structures
Homoplasy
Ichthyosaur & dolphin
Evolutionary History of
Genome Change
Homologous Genes:
Orthologous genes
Paralogous genes
Molecular Clock
Method for estimating the time of evolutionary
change, based on genes that evolve at constant
rates
 # nucleotide substitutions is proportional to
elapsed time since species diverged from
common ancestor
 Compare number of genetic differences with
known evolutionary dates from fossil record to
calibrate
 Average rate of genetic change can estimate
date of divergence events unknown from fossils

Molecular Clock
4 base pairs different
1 bp changes per 25 million years
= 100 million years of evolution occurring between
the 2 species (4*25)
= 50 million years each
50 my since the common ancestor
#bps/rate/2 = time since divergence
Diagram: evolution.berkeley.edu
The figure shows an analysis of the evolution of the
hemoglobin protein in vertebrates from sharks to humans.
The straight line indicates that the evolution has occurred at
a constant rate. According to the graph, on average,
approximately18% of amino acids change in hemoglobin per
100 million years.
What percentage change per1 million years?
According to the fossil record, orangutans and African apes
diverged 13 million years ago. Based on the average rate
shown, calculate the expected percent difference in
hemoglobin between orangutans and African apes.
Bonobos and common chimpanzees are the closest extant
relative to humans. Given that they only have a 0.468%
difference in hemoglobin amino acid sequence, use the
average rate of amino acid changes (from above) to calculate
the time since divergence.

Taxon (pl. – taxa)
◦ Sister taxa
Nodes
 Polytomy
 Homology

◦ Vestigial structures











Homoplasy
Analogy
Convergent evolution
Monophyletic group
Paraphyletic/Polyphyletic group
Shared ancestral character
Shared derived character
Outgroup
Maximum parsimony/ Maximum likelihood
Orthologous vs Paralogous Genes
Molecular Clock