No Slide Title

download report

Transcript No Slide Title

Transcription
&
Translation
It’s all about
making...
Here is an...
DNA not only stores information,
but accurately passes it on
through replication & RNA
transcription.
Helicase &
RNA
polymerase
DNA unwinds and
unzips (Helicase).
Coding Strand
RNA Polymerase
binds to and moves
along a DNA strand.
RNA nucleotides
are joined in order
complimentary to
the DNA nucleotide
sequence.
mRNA Nucleotides
mRNA Nucleotides
Helicase
&
A nice image of the same thing!
There are three
kinds of ...
1) mRNA (Messenger)
2) rRNA (Ribosomal)
3) tRNA (Transfer)
Single strand
complementary
to the template
strand.
Messenger RNA (mRNA) carries the DNA message out of the
nucleus and into the cytoplasm to ribosomes, the site of
protein synthesis.
tRNA
tRNA UACGGCAAUCUGGCAAUCGCCUGGACUG
Single strand
complementary
to the coding
strand.
Transfer RNA (tRNA) leaves the nucleus, binds to the amino
acid specified by it’s anticodon and transfers it to the ribisome
where it meets up with mRNA to assemble a protein.
Processing
results in a
“T” shape,
with an
amino acid
binding site
at one end
and an
anticodon
at the other.
Ribosomal RNA (rRNA)
is RNA in globular form.
It joins with 83 proteins
to form a ribosome. The
sites labeled “P” and “A”
bind tRNA. The “groove”
formed between the two
subunits is the site of
mRNA binding.
AKA
Here is an...
DNA not only stores information,
but accurately passes it on
through replication & RNA
transcription.
Here’s where
it all comes
together!!!
mRNA,
carrying the
codon and
tRNA, carrying
the anticodon,
meet at the
ribosome
(rRNA) to
piece together
amino acids.
Here’s how
it works...
Ribosome
rRNA
+
Protiens
Here it is all together!
Anticodon
Codon
A nice image of the same thing!
This is a
representation of
one molecule of
hemoglobin. It
is the result of
amino acids
strung together
into peptides,
joined to form
polypeptides
which combine
to make up the
final protein.
The result...
Anticodon
Codon
A nice image of a protein being made!
How about
a review?