Transcript Interleukin-2

Interleukin-2: Its role in treating HIV
infected patients and the possible way
to produce it
Prasit Faipenkhong
Production group
Outlines
•Introduction
•Clinical aspect of aldesleukin (human IL-2 derivative)
•Production aspect aldesleukin (human IL-2 derivative)
•Summary
Introduction
•Interleukin-2 (IL-2)
cytokines
helper T cells (CD4+ T cells), cytotoxic T cells (Tc, CD8+
T cells), natural killer cells (NK cells)
induce proliferation and differentiation of CD4+ T cells
and cytotoxic T cells
induce B cell proliferation, stimulate macrophage
activity, increase number and toxicity of NK cells
production is decrease in HIV infected patients
Introduction
•Aldesleukin
a human IL-2 derivative
recombinant DNA technique
absence of an N-terminal alanine, replacement of
cysteine with serine at position 125, absence of
glycosylation
Diagram of the amino acid sequence of
aldesleukin
Introduction
•Aldesleukin
possess immunological activities similar to those
observed with native IL-2
has been approved by FDA for treating metastatic renal
cell carcinoma and metastatic melanoma
phase III clinical trials in HIV infected patients
Clinical aspect of aldesleukin
•What Does the Research Show?
•Who Should Use It?
•Pregnant Women and Children
•What About Side Effects?
•How to Use It?
•How to Get It?
What Does the Research Show?
•Subcutaneous, intravenous, intramuscular
daily, weekly, monthly and every two months
very low doses (1 million International Units, or IU) to
higher doses (18 million IU)
•Immunological benefits in several clinical trials
increase CD4+ cells without sustained increase in viral
load
•Duration of intermittent IL-2 therapy appear to be
important
What Does the Research Show?
•Subcutaneous injection is similar to intravenous infusion
improvement in immunological parameter
•Lower dosage of IL-2 (3 MIU/day) are still effective
increase CD4+ counts
•No difference in viral load in group receiving IL-2 +
antiretroviral therapy
•IL-2 + HART may reduce the latent reservoir
What Does the Research Show?
•French regulatory agency approve a Compassionate
Use Program of aldesleukin for people with CD4+ counts
below 200 and HIV levels below 1,000
Who Should Use It?
•Can be used safely by people at all levels of CD4+ cell
counts
•People with high detectable viral loads
•People with an active infection, heart problems, lung
diseases, autoimmune diseases, DM, thyroid problems
•People facing extreme fatigue
Pregnant Women and Children
•Pregnant women
•Children
What About Side Effects?
•Flu-like symptoms
•Swelling, redness, or lumps
•Sinus congestion, low blood pressure, liver toxicity,
swelling due to water retention, nausea and vomiting,
diarrhea, peeling skin, changes in mental status, and
altered blood levels including albumin, potassium,
magnesium, calcium, red blood cells, and platelets
•Worst on the last two or three days of a five-day course
What About Side Effects?
•Oliguria or anuria, shortness of breath, high fever that
doesn't go away with OTC drugs, major changes in
mental status, faint, major swelling
How to Use It?
•Subcutaneous, 9-15 MIU/day, bid, five consecutive days
every eight weeks
•The time between courses of IL-2 therapy will be increased
by four-week period
•Continuous intravenous, 9-18 MIU/day, five consecutive
days, every eight weeks
How to Get It?
•several ongoing studies
off label use
Production aspect aldesleukin
•Preparing IL-2 cDNA libraries
•Screening and identification of IL-2 cDNA clones
•Cloning of IL-2 gene into M13 vector
•Oligonucleotide-directed Mutagenesis
•Screening and Identification of Mutagenized Phage
Plaques
•Recloning of the Mutagenized IL-2 Gene for Expression
in E. coli
Preparing IL-2 cDNA libraries
•A collection of plasmid cloning vectors carrying both
complete or incomplete IL-2 cDNA
•Procedure
Preparing IL-2 cDNA libraries
PBL or Jurkat cells
mitogen
Collect of mRNA for IL-2
Convert to double strand DNA (cDNA)
Join into a plasmid cloning vector
IL-2 cDNA libraries
Transform host cells
Synthesis of
cDNA
Preparing IL-2 cDNA libraries
PBL or Jurkat cells
mitogen
Collection of mRNA for IL-2
Convert to double strand DNA (cDNA)
Join into a plasmid cloning vector
IL-2 cDNA libraries
Transform host cells
Screening and identification of IL-2
cDNA clones
•To identify the colonies of host cells that carry complete
IL-2 cDNA
•DNA hybridization, immunological assay, protein
activity
•Rescreen with the probe, confirm by restriction mapping
DNA hybridization
Screening and identification of IL-2
cDNA clones
•To identify clones that carry a specific plasmid-cDNA
construct
•DNA hybridization, immunological assay, protein
activity
•Rescreen with the probe, full length clones were identified
and confirmed by restriction mapping
Cloning of IL-2 gene into M13 vector
•Single stranded DNA template
•Procedure
Cloning of IL-2 gene into
M13
vector
Oligonucleotide-directed Mutagenesis
•To engineer the IL-2 gene in order to get the the IL-2
derivative which has suited physical and chemical
properties
•Cysteine125 to serine
•Decrease an aggregated oligomeric form when isolated
from bacterial cells
Decrease an aggregated inactive oligomeric form upon
storage
•Procedure
Oligonucleotide-directed Mutagenesis
M13-IL2 (double strand)
M13-IL2 (single strand)
Add synthetic oligonucleotide primer
GATGATGCTCTGAGAAAAGGTAATC
Add Klenow fragment and dNTPs
Add T4 DNA ligase
Transform E. coli
Produce M13 plaques
Screening and Identification of
Mutagenized Phage Plaques
•To identify clones that contain mutated sequence of IL-2
gene
•Procedure
Screening and Identification of
Mutagenized Phage Plaques
Hybridization
Digest with restriction enzyme DdeI
Inoculate one clone called M13-LW46 into a culture of
JM103 E. coli
Prepare RF-DNA from the pellet of cell culture plate
Recloning of the Mutagenized IL-2 Gene
for Expression in E. coli
•To express the mutagenized IL-2 gene
•Procedure
Recloning of the Mutagenized IL-2 Gene
for Expression in E. coli
RF-DNA from M13-LW46
Plasmid pTrp3
Ligated plasmid called pLW46
Tranform into E. coli
Restriction enzyme mapping
E. coli transformed with pLW46
Restriction map of ptrp3
Restriction map of pLW46
Summary
•Aldesleukin, human IL-2 derivative, is produced by
recombinant DNA technique.
It has been approved by FDA for treating certain types
of kidney and skin cancer.
Now, it is under phase III clinical trials in HIV infected
patients.
•Principle of microbial growth, maximizing the efficiency
of fermentation process, bioreactors, typical large-scale
fermentation, harvesting microbial cells, disrupting
microbial cells, and downstream processing