Transcript Pharmacogenomics and Personalized Medicine

Pharmacogenomics and Personalized Medicine:
an Education and Implementation Perspective
Michael D. Kane, PhD
(1) Associate Professor of Bioinformatics, Department of Computer & Information Technology, College of Technology
(2) University Faculty Scholar, Purdue University
(3) Lead Genomic Scientist, Bindley Bioscience Center at Discovery Park, Purdue University
(4) Visiting Research Scientist, College of Pharmacy, Ohio Northern University.
Purdue University
West Lafayette, Indiana, USA
bioinformatics.tech.purdue.edu
OUTLINE:
Background
Course Development & Delivery
Research Projects
Vision Statement
Conclusion
Background
Ph.D. from Purdue University - School of Pharmacy; Molecular Pharmacology
Industry Experience;
Scientist: Pfizer, Inc., R&D in Genomics
Vice President: Genomic Solutions, Inc., R&D (Oligo, ArrayIQ)
Co-founder and President: Nucleico, LLC, (Spanscript, SURFER)
Co-founder and CSO: Genomic Guidance, LLC
Co-founder and Consultant: BATS, Inc.
Academic Experience;
Primary appointment; Dept. of Computer and Information
Technology, Purdue University
Lead Genomic Scientist, Bindley Bioscience Center at Discovery Park,
Purdue University
Visiting Research Scientist, College of Pharmacy, Ohio Northern University
Adjunct Professor, Biology, Eastern Michigan University
Other;
Expert Witness, DNA Forensics
Course Development and Delivery
Purdue University
Biomedical Informatics (upper undergrad course, 3 cr. hrs.)
Examination of computational life sciences and health informatics,
where computing students apply their skills.
Bioinformatics Computing and Systems Integration (grad course, 3 cr. hrs.)
Hands-on cluster computing course, students utilize both VM and
blade systems to build clusters, install OS and scientific software,
assess and improve system performance.
Course Development and Delivery
Purdue University
Genomic Technologies (grad, 1 cr. hr., for the CLS AOS*)
Discovery Information Systems (grad, 1 cr. hr., for the CLS AOS*)
Biomedical Systems Architectures (grad, 1 cr. hr., for the CLS AOS*)
Biomedical Systems Analysis and Design (grad, 1 cr. hr., CLS AOS*)
Introduction to Computational Life Sciences (undergrad, 1 cr. hr.)
Co-developed w/ Purdue Colleagues;
Quantitative Research Methods (grad, 3 cr. hrs.)
Research Seminar Series in Technology (grad, 1 cr. hr.)
Introduction to Electric Vehicle Technology (undergrad, 3 cr. hrs.)
Electric Vehicle Systems (grad, 3 cr. hrs.)
*CLS AOS; Computational Life Sciences Area of Specialization, these courses were created in support of this interdepartmental, interdisciplinary program providing bioinformatics training for MS and PhD graduate students.
Course Development and Delivery
Ohio Northern University, College of Pharmacy
2011-2012
Visiting Research Scientist (Academic Sabbatical), Department of
Pharmaceutical and Biomedical Sciences, College of Pharmacy,
Ohio Northern University, Ada, Ohio.
1997-Present
Adjunct Professor of Pharmacology, Department of Pharmaceutical
and Biomedical Sciences, College of Pharmacy, Ohio Northern
University, Ada, Ohio.
Provide instruction each semester in the areas of
(1) the genetic and molecular basis of neurological diseases,
(2) the pathophysiology and treatment of Alzheimer’s disease,
(3) genomics and personalized medicine.
Course Development and Delivery
Dublin Institute of Technology
2010, Summer
Visiting Faculty Member, School of Manufacturing and Design
Engineering, Dublin, Ireland.
Developed and delivered a 4-week graduate course entitled “Clinical and Non-Clinical Applications of
Genomic Screening Technologies”.
Patent Application:
Kane, M.D., Duffy, P., Applegate, B., Savakhin, S., Walsh, P., and Woods, G. One-Step DNA
Detection System (2011).
Research Projects: Environmental Toxicology
Development of Tools for Environmental Assessment and Real-Time
Sensing of Contaminants (Showalter Trust)
1. Johns, S.M., Denslow, N.D., Kane, M.D., Watanabe, K.H., Orlando, E.F., and Sepúlveda, M.S. Effects of
estrogens and antiestrogens on gene expression of fathead minnow (Pimephales promelas) early life
stages. Environmental Toxicology 26(2): 195-206, 2011.
2. Johns, S.M., Kane, M.D., Denslow, N.D., Watanabe, K.H., Orlando, E.F., Villeneuve, D.L., Ankley, G.T.
and Sepúlveda, M.S. Characterization of Ontogenetic Changes in Gene Expression in the Fathead
Minnow (Pimephales promelas). Environmental Toxicology and Chemistry 28(4): 873-880, 2009.
3. Kane, M.D., Springer, J.A., Iannotti, N.V., Gough, E.S., Johns, S.M., Schlueter, S.D. and Sepulveda,
M.S. Identification of Development and Tissue-Specific Gene Expression in the Fathead Minnow
Pimephales promelas, Rafinesque using Computational and DNA Microarray Methods. Journal of Fish
Biology 72, 2341-2353, 2008.
Research Projects: Pathogen Detection
Center for Food Safety Engineering: Developing Biosensors to Detect
Foodborne Microbial and Chemical Hazards (USDA)
Development of Tools for Environmental Assessment and Real-Time
Sensing of Contaminants (Showalter Trust)
1. Kim, H., Kane, M.D., Kim, S., Dominguez, W., Applegate, B.M, and Savikhin, S. A Molecular Beacon
DNA Microarray System for Rapid Detection of E. coli O157:H7 that Eliminates False Signal Risk.
Biosensors and Bioelectronics 15:1041-1047, 2007.
2. Perry, L., Heard, P., Kane, M., Kim, H., Savikhin, S., Dominguez, W., Applegate, B. Application of
multiplex PCR to the detection of pathogens in food. Journal of Rapid Methods and Automation in
Microbiology 15: 176-198, 2007.
Research Projects: Personalized Medicine
An Interactive Software System for Integrating Clinical Genotyping with
Prescription Drug Safety Assurance. (Microsoft Research)
1. Springer, J.A., Iannotti, N.V., Sprague, J.E., and Kane, M.D. Construction of a drug safety assurance
information system based on clinical genotyping. ISRN Bioinformatics. (982737, 9 pages), 2012.
2. Springer, J.A., Iannotti, N.V., Kane, M.D., Haynes, K., and Sprague, J.E. Teaching drug safety and
pharmacogenomics: a practicum learning environment enabled by a dedicated personalized medicine
instructional software system. American Journal of Pharmaceutical Education, 75(2):32-34, 2010.
3. Likovich, M., Derr, A., Kisor, D.F, Kane, M.D., and Sprague, J.E. Personalized Medicine and the Future
of Pharmacy Practice. Pharmacy Times April, 2010.
4. Sprague, J.E., Sullivan, D.L., and Kane, M.D. Personalized Medicine: Pharmacogenetics as a Method
for Improving Patient Outcomes. Ohio Pharmacist 57(11): 13-18, 2008.
5. Kane, M.D., Springer, J.A., and Sprague, J.E. Drug Safety Assurance through Clinical Genotyping:
Near-Term Considerations for a System-Wide Implementation of Personalized Medicine. Personalized
Medicine 5(4): 387-397, 2008.
6. Kane, M.D. and Summers, K.H. Challenges and opportunities in pharmacogenomics and
therapeutics. Journal of Managed Care Pharmacy 13(7): 607-608, 2007.
(Patent application) Kane, M.D., Springer, J.A., Sprague, J.E., and Iannotti, N.V. Method for Utilizing
Patient Genotyping for Drug Safety. 61/031,527 (2008).
Research Projects: Personalized Medicine (Key Issues)
Genetic Variance: Single Nucleotide Polymorphisms (SNPs) are differences in the DNA.
They represent 90% of all human genetic variations. Genetically similar to a mutation, but
distinct in that a SNP is not causal to a clinical disease or disorder.
Genetic Inheritance: The appearance of deleterious mutations during evolution tend to
NOT be inherited for obvious reasons (those that affect growth, reproduction and
viability). Our modern existence is the result of millions of years of tolerated (and
occasionally beneficial) changes in our genome, which is most often evident in what
natural products we can and cannot eat or consume (evolutionary pressure & natural
selection).
Natural Products vs. Modern Pharmaceuticals: Differences in our genome and our
response to these compounds
Natural Selection vs. Modern Life Span: We are the 10th generation of humans on earth
with an average life span >40 years old!
Personalized Medicine involves understanding how some genetic markers impact drug
safety and efficacy, and PREDICTING how a patient will respond to a specific drug/dose
(based on the patient’s genetic profile). For the healthcare consumer, most of these
genetic differences have an effect on (1) drug metabolism (pharmacokinetics) or (2) drug
action (pharmacodynamics).
Research Projects: Personalized Medicine
Adverse Drug Reactions
o More than 770,000 patients die or sustain serious injury every year in
the U.S. from Adverse Drug Reactions (ADRs).
o ADRs are the 5th leading cause of death in the United States and are
one of the leading, preventable public health issues today.
o In terms of total health care dollars, ADRs cost the U.S. health care
system between $1.5 and $5.4 billion per year.
o It is estimated that human genetic variation (SNPs) have been account
for approximately 30% of all ADRs.
o 1 in 5 people in the US harbor a SNP that alters the drug metabolism
or drug activity of at least one FDA approved drug.
Pharmacogenomics and Personalized Medicine
EXAMPLE: Warfarin (Coumadin): Anticoagulation. If you are prescribed WARFARIN,
you have a condition that may generate potentially life-threatening blood clots. If you are
dosed with too much WARFARIN you could experience serious complications due to
internal bleeding, yet if you are dosed with too little WARFARIN you may be in danger of
serious consequences associated with circulating emboli due to excessive blot clotting.
Warfarin Metabolism (hepatic)
CYP2C9 to 6-hydroxywarfain
Warfarin Drug Action (circulator system)
Vitamin K Epoxide Reductase Complex 1
(VKORC1) Inhibitor
Pharmacogenomics and Personalized Medicine
GENESCRIPTION was developed as an educational tool that models the
FUTURE of applied personalized medicine.
The online portal models a drug dispensing environment (pharmacist) where the
user is presented with a patient that has:
1) DNA screened to identify any SNPs related to drug safety and efficacy.
2) Prescribed a drug that is affected by a SNP related to drug safety and efficacy.
3) Provides predictive information regarding the safety and efficacy of the
prescribed drug in the patient.
www.genescription.com
Genescription is a free, online
instructional utility available to the public,
and can be accessed and utilized by
anyone with an internet connection.
Dosing curve of a 10 mg oral dose in a “normal” metabolizer
From: www.genescription.com
Dosing curve of a 10 mg oral dose in a “poor” metabolizer
From: www.genescription.com
Dosing curve of a 10 mg oral dose of Warfarin in a “poor” metabolizer
From: www.genescription.com
Dosing curve of a 10 mg oral dose of Warfarin in a VKORC1-SNP Patient
From: www.genescription.com
Research Projects: One-Step DNA Detector
CATTTCCCGTGGTTGCTTGCGTTTGAGACTGGAAATG
NH2
Palindromic Sequence
Kane, M.D., Duffy, P., Applegate, B.,
Savakhin, S., Walsh, P., and Woods, G.
One-Step DNA Detection System (2011).
(Patent Application)
Research Projects: One-Step DNA Detector
From: Kim, H., Kane, M.D., Kim, S., Dominguez, W., Applegate, B.M, and Savikhin, S. A
Molecular Beacon DNA Microarray System for Rapid Detection of E. coli O157:H7 that
Eliminates False Signal Risk. Biosensors and Bioelectronics 15:1041-1047, 2007
Vision for Success in Higher Education
Programmatic Goals
Vision for Success in Higher Education
Challenges:
Opportunities:
Uncertain Economics
Diversify Sources of Revenue
Uncertain Career Path
Inclusive Curriculum
Value of Curricular Skills
Establish and Leverage Active Partnerships
(School of Medicine, Nursing, Pharma,
Biotech, etc.)
Develop and Leverage Resources
Industrial Advisory Board
Student-Facilitated Recruiting
Alumni Association
IU Research and Technology Commercialization Corp.
Inter-Institutional Collaborations
Online Education Programs
Thank You!