Transcript Genetic Approaches to Studying Genome Function

The genetics of heterochromatin
in metazoa
MCB 140 11/29/06
1
MCB 140 11/29/06
3
Hermann Joseph Muller
1946 Nobel Prize in Medicine:
"for the discovery of the production of
mutations by means of X-ray irradiation"
MCB 140 11/29/06
4
The true meaning of "red eye reduction":
White wild-type
White mutant
MCB 140 11/29/06
5
12.14
MCB 140 11/29/06
6
12.14
MCB 140 11/29/06
7
Gene behavior can change depending on
where on the chromosome the gene lies.
= “position effect” (bar is the most commonly used example)
“Position effect variegation” (PEV): cell-to-cell
variability of expression of a gene that has been relocated
to a new position in the genome.
Epigenetic phenomenon:
Stable change in expression without change in sequence!
MCB 140 11/29/06
8
Enhancer of PEV
Suppressor of PEV
MCB 140 11/29/06
9
2 genes:
Su(var)2-5
Su(var)3-9
MCB 140 11/29/06 10
MCB 140 11/29/06 11
MCB 140 11/29/06 12
HP1
(Sarah Elgin)
(heterochromatin protein 1)
Identified in a BIOCHEMICAL
scheme to discover proteins
that are associated with
heterochromatin.
MCB 140 11/29/06 13
MCB 140 11/29/06 14
biochemistry
genetics
HP1 = Su(var)2-5
Conserved in humans and in mice
(both in terms of sequence and intranuclear
location!).
Why does HP1 go to places that HP1 goes to?
MCB 140 11/29/06 15
“Biochemical epistasis”
(T. Jenuwein)
Overexpression of mouse Su(var)3-9 leads to
a MASSIVE redistribution of HP1 in the
nucleus of mouse cells.
MCB 140 11/29/06 16
Who would have thunk it?
NCBI: Su(var)3-9 contains a domain (the
SET domain) that is somewhat similar to,
ahem, RUBISCO methyltransferase.
Su(var)3-9 is a HISTONE methyltransferase.
MCB 140 11/29/06 17
Histone methylation
MCB 140 11/29/06 18
Calling David Duchovny
and Gillian Anderson
• Su(var)3-9 was given this name because it
was the 9th gene isolated on the 3rd
chromosome in a screen for Su(var)s.
• It methylates lysine 9 in histone H3.
This was discovered 18 years after it was
named.
MCB 140 11/29/06 19
And finally
• HP1 preferentially BINDS histone H3
methylated on lysine 9.
• That’s why Su(var)3-9 determines
localization of HP1 to heterochromatin (it
methylates histones in heterochromatin).
• At least in fission yeast, and perhaps in
worms, this has to do with RNAi. 
MCB 140 11/29/06 20
MCB 140 11/29/06 21
MCB 140 11/29/06 22
HP1
HP1
MCB 140 11/29/06 23
HP1
HP1=HP1
HP1=HP1
HP1=HP1
HP1
MCB 140 11/29/06 24
Remembrance of things past:
chromatin as an epigenetic vehicle
MCB 140 11/29/06 25
Homology
(orthologs of heterochomatin proteins
in fission yeast, insects, and humans)
MCB 140 11/29/06 26
Analogy
Fission yeast, flies, mammals.
Budding yeast.
MCB 140 11/29/06 27
Nature, October 10, 2002
The polycomb group protein EZH2 is involved in progression of
prostate cancer
Varambally et al.
Prostate cancer is a leading cause of cancer-related death in males and is
second only to lung cancer. Although effective surgical and radiation
treatments exist for clinically localized prostate cancer, metastatic prostate
cancer remains essentially incurable. Here we show, through gene
expression profiling, that the polycomb group protein enhancer of zeste
homolog 2 (EZH2) is overexpressed in hormone-refractory, metastatic
prostate cancer. … Dysregulated expression of EZH2 may be involved in the
progression of prostate cancer, as well as being a marker that distinguishes
indolent prostate cancer from those at risk of lethal progression.
MCB 140 11/29/06 28
From egg to embryo
?
29
30
Homeotic mutations (W. Bateson)
Genetics
Allele
Heterozygous
Homozygous
“… Not that there has merely
been a change, but that
something has been changed
into the likeness of something
else.”
MCB 140 11/29/06 31
wt
antennapedia
MCB 140 11/29/06 32
MCB 140 11/29/06 33
The segmentation hierarchy
34
“Do you have any idea who I think I am?!!”
1. Segment identity is determined by transcription
factors.
2. They act on target genes only transiently. Then
they go away, and the activity of their targets is
maintained by large complexes: Polycomb
represses genes, and Trithorax activates them.
3. Nobody knew how Polycomb and Trithorax do
this.
MCB 140 11/29/06 35
How Polycomb and Trithorax work
MCB 140 11/29/06 36
extra sex combs
enhancer of zeste
MCB 140 11/29/06 37
E(z) does it
Posted September 13, 2002 – CELL immediate early publication
Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A., and Pirrotta, V.
Drosophila Enhancer of Zeste/ESC complexes have a histone H3
methyltransferase activity that marks chromosomal Polycomb sites.
Cell. Published online September 13, 2002.
10.1016/S0092867402009753
Müller, J., Hart, C.M., Francis, N.J., Vargas, M.L., Sengupta, A., Wild,
B., Miller, E.L., O'Connor, M.B., Kingston, R.E., and Simon, J.A.
Histone methyltransferase activity of a Drosophila Polycomb group
repressor complex. Cell. Published online September 13, 2002.
10.1016/S0092867402009765
MCB 140 11/29/06 38
MCB 140 11/29/06 39
“Influential ideas are always
simple. Since natural
phenomena need not be
simple, we master them, if
at all, by formulating simple
ideas and exploring their
limitations.”
Al Hershey
MCB 140 11/29/06 40
stimulus
+
+
Regulation of genes occurs via the interaction of transacting factors (proteins) with cis-acting sequences
near the genes themselves.
MCB 140 11/29/06 41
MCB 140 11/29/06 42
43
Bicoid is the anterior
morphogen
44
MCB 140 11/29/06 45
What democracy, I mean, gene
regulation, is really like
• Trans-acting factors do not distribute in the nucleus
based on the primary sequence of the genome: some
factors fail to bind most genes that have sequences
waiting for them, and other factors bind a large number
of genes that do NOT have sequences for them
• Even when a factor binds next to a gene, many times,
nothing happens; the same factor bound to two different
genes can exert diametrically opposite effects
• Most genes in the human genome are under
considerable regulatory influence from entities other than
“simple” trans-acting factors; these entities include
noncoding RNA and modified histones
MCB 140 11/29/06 46
Boyer and Young
Cell Sept. 23, 2005
MCB 140 11/29/06 47
David Allis: “the histone code”
Fischle, Wang, Allis COCB 2003
1963-2000
2000 - …
Henry et al. (11/1/2003) Genes Dev. 17: 2648.
MCB 140 11/29/06 51
Genetic information
Lac operator
gaattgtgagcggataacaattt
Genetic information
-
Genetic information
+
?